SimSeq | illumina paired-end and mate-pair short read simulator

SimSeq is a C library. SimSeq has no bugs, it has no vulnerabilities and it has low support. However SimSeq has a Non-SPDX License. You can download it from GitHub.

simseqnbproject currently contains the net beans project with the initial source. geterrorprofile contains the c source for the program that generates the error model for the sequence simulator. this program utilizes a subset of the kent source library (which is freely available for both commercial and non-commercial use (see readme in "thirdparty/kent" for more information). examples contains some things to run this on. right now there is an example mitochondrial sequence, and an example error profile from a 100 bp illumina gaiix dataset. you can simulate any read less than or equal to 100bp in length using that error profile. usage: java -jar -xmx2048m simseq.jar [required options] [options] last updated: 4.12.2011 -1,--read1_length integer length of first read. default: 100 -2,--read2_length integer length of second read. default: 100 --adapter1 the first read illumina adapter sequence to use when the insert size is less than the read length. currently only works on paired end simulation. defalt:agatcggaagagcggttcagcaggaatgccg agaccg --adapter2 the second read illumina adapter sequence to use when the insert size is less than the read length. currently only works on paired end simulation. defalt:agatcggaagagcgtcgtgtagggaaagagt gt -d,--dip if diploid data desired, path to diploid file. (format: chrom pos(0 based) altchar --debug write debug info to