atc | STM32 LL AT-Command parser

by nimaltd C Version: 3.0.1 License: GPL-3.0

X-Ray Key Features Code Snippets(1)Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | atc Summary

atc is a C library typically used in Internet of Things (IoT) applications. atc has no bugs, it has no vulnerabilities, it has a Strong Copyleft License and it has low support. You can download it from GitHub.

STM32 LL AT-Command parser

Support

Quality

Security

License

Reuse

Support

atc has a low active ecosystem.

It has 98 star(s) with 23 fork(s). There are 6 watchers for this library.

It had no major release in the last 6 months.

There are 3 open issues and 1 have been closed. On average issues are closed in 545 days. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of atc is 3.0.1

Quality

atc has 0 bugs and 0 code smells.

Security

atc has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

atc code analysis shows 0 unresolved vulnerabilities.

There are 0 security hotspots that need review.

License

atc is licensed under the GPL-3.0 License. This license is Strong Copyleft.

Strong Copyleft licenses enforce sharing, and you can use them when creating open source projects.

Reuse

atc releases are not available. You will need to build from source code and install.

Installation instructions are not available. Examples and code snippets are available.

Top functions reviewed by kandi - BETA

kandi's functional review helps you automatically verify the functionalities of the libraries and avoid rework.
Currently covering the most popular Java, JavaScript and Python libraries. See a Sample of atc

Get all kandi verified functions for this library.

atc Key Features

No Key Features are available at this moment for atc.

atc Examples and Code Snippets

Checks to see if a string is displayed

javascript

Lines of Code : 13

License : Permissive (MIT License)

Copy

function hasPalindromePermutation(string) {
  const map = new Map();
  const cleanString = string.toLowerCase().replace(/\s/g, '');

  for(const char of cleanString) {
    map.set(char, (map.get(char) || 0) + 1);
  }

  const values = Array.from(map.

Community Discussions

Trending Discussions on atc

Ignoring incomplete triplet in protein translation

Variables not being reassigned in Loop

Remove empty lists from a tibble in R

Iterating through dictionary lists with another list, and finding associated key of value

How to correctly loading shp file by code

Clean trailing period if present as last non whitespace of dataframe column

how to get id of clicked add to cart button from eight button

[Discord.js]MessageEmbed field values must be non-empty strings

How to adjust how far sliding window slides (step)

Replace function for replacing characters in any combination

QUESTION

Ignoring incomplete triplet in protein translation

Asked 2022-Mar-26 at 01:02

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

...

ANSWER

Answered 2022-Mar-26 at 00:31

You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):

Change

Source https://stackoverflow.com/questions/71624409

QUESTION

Variables not being reassigned in Loop

Asked 2022-Feb-19 at 04:55

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

...

ANSWER

Answered 2022-Feb-19 at 04:55

I did some refactoring. Can you try the following code?

Source https://stackoverflow.com/questions/71181881

QUESTION

Remove empty lists from a tibble in R

Asked 2022-Feb-16 at 08:12

I am trying to remove any list from my tibble that has ""

...

ANSWER

Answered 2022-Feb-16 at 08:12

You can do:

Source https://stackoverflow.com/questions/71125448

QUESTION

Iterating through dictionary lists with another list, and finding associated key of value

Asked 2022-Feb-04 at 22:09

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

...

ANSWER

Answered 2022-Feb-04 at 22:06

At the following line:

Source https://stackoverflow.com/questions/70993124

QUESTION

How to correctly loading shp file by code

Asked 2022-Jan-13 at 16:46

I am trying to load a .shp file by OGRFeatureSource class, and it is not showing in the scene, but when I load .earth file, using osgearth_viewer by arguments, the shape file works.

Any errors are printing on terminal.

I based my code on tutorials that i found on web, but i think these are for an old version (some classes of these tutorials no longer work.) The program is not crashing.

Here is my code:

...

ANSWER

Answered 2022-Jan-13 at 16:46

Your AltitudeSymbol also needs to specify the clamping:

Source https://stackoverflow.com/questions/70698391

QUESTION

Clean trailing period if present as last non whitespace of dataframe column

Asked 2021-Dec-23 at 08:18

Here's a sample of the data I'm working on(first line are the column names):

...

ANSWER

Answered 2021-Dec-23 at 08:18

I can not reproduce why the non matching lines are returned as empty, but if you load the example data as csv, set the separator to ; and only match the dot at the end of the string using between optional whitespace chars using \s*\.\s*$ you will get the desired replacement leaving unmatched lines untouched.

Example

Source https://stackoverflow.com/questions/70413374

QUESTION

how to get id of clicked add to cart button from eight button

Asked 2021-Dec-15 at 09:58

****This is my html code This is only part of html code which I have button ****

...

ANSWER

Answered 2021-Dec-15 at 09:33

button.addEventListener('click', event => {
 console.log(event.target.id)
});

Source https://stackoverflow.com/questions/70361176

QUESTION

[Discord.js]MessageEmbed field values must be non-empty strings

Asked 2021-Dec-12 at 02:04

I have A Some Problem.
I spent three days trying to fix this, but I didn't succeed.
I need your help.

My Error Code is

...

ANSWER

Answered 2021-Dec-12 at 01:18

Some of the values extracted are numbers, but the embed only take non-empty strings as the 2 first arguments for fields.

You need to get Strings for the 2 values you are not concatenating to strings like so:

Source https://stackoverflow.com/questions/70320214

QUESTION

How to adjust how far sliding window slides (step)

Asked 2021-Dec-02 at 16:40

I am trying to adjust how far the window slides in a sliding window. I see that there are a lot of posts about sliding windows on SO, however, I can’t seem to find a post that explains how to adjust how far the distance the sliding window slides. I am also not necessarily interested in chunking or only adjusting window size (1,2).

As an example If I had a string of six characters

...

ANSWER

Answered 2021-Dec-02 at 15:55

I'm sure there are more elegant solutions to this. Whenever I find myself using range(len(some_iterable)) I feel a little dirty.

That being said, you could achieve this with a simple generator.

Source https://stackoverflow.com/questions/70202030

QUESTION

Replace function for replacing characters in any combination

Asked 2021-Nov-30 at 22:03

I am working with genetic data. I am trying to create a function that replaces the 1st,2nd, and 3rd characters of a string in any combination. Additionally, I was hoping to avoid replacing a character that is already in that position.

So I have code that will take a string of nucleotides and split them into groups of three nucleotides.

...

ANSWER

Answered 2021-Nov-30 at 22:03

Below is a generator function that generates all those mutations you are asking:

Source https://stackoverflow.com/questions/70176376

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install atc

You can download it from GitHub.

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at: