cca | Canonical Correlation Analysis | Dataset library

by surban Python Version: Current License: No License

X-Ray Key Features Code Snippets Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | cca Summary

cca is a Python library typically used in Artificial Intelligence, Dataset applications. cca has no bugs, it has no vulnerabilities and it has low support. However cca build file is not available. You can download it from GitHub.

Canonical Correlation Analysis

Support

Quality

Security

License

Reuse

Support

cca has a low active ecosystem.

It has 10 star(s) with 6 fork(s). There are 2 watchers for this library.

It had no major release in the last 6 months.

cca has no issues reported. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of cca is current.

Quality

cca has 0 bugs and 0 code smells.

Security

cca has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

cca code analysis shows 0 unresolved vulnerabilities.

There are 0 security hotspots that need review.

License

cca does not have a standard license declared.

Check the repository for any license declaration and review the terms closely.

Without a license, all rights are reserved, and you cannot use the library in your applications.

Reuse

cca releases are not available. You will need to build from source code and install.

cca has no build file. You will be need to create the build yourself to build the component from source.

It has 54 lines of code, 2 functions and 1 files.

It has low code complexity. Code complexity directly impacts maintainability of the code.

Top functions reviewed by kandi - BETA

kandi has reviewed cca and discovered the below as its top functions. This is intended to give you an instant insight into cca implemented functionality, and help decide if they suit your requirements.

Compute the covariance matrix .
Sorts the eigenvalues and eigenvectors

Get all kandi verified functions for this library.

cca Key Features

No Key Features are available at this moment for cca.

cca Examples and Code Snippets

No Code Snippets are available at this moment for cca.

Community Discussions

Trending Discussions on cca

How do I export a dataframe produced by R?

Ignoring incomplete triplet in protein translation

Data objects not found in embedded vegan:cca. Scoping issue?

Endpoints Resolution Error - OAuth v2 Azure - msal-node

Select argument doesn't work on cca objects

ZMQ detect client unavailability with heartbeat

Variables not being reassigned in Loop

Trying to get spaces between codons and stop the generation when reaching a certain codon for RNA to protein simulation

RNA to Protein simulation program's TypeErorr?

Iterating through dictionary lists with another list, and finding associated key of value

QUESTION

How do I export a dataframe produced by R?

Asked 2022-Apr-14 at 16:47

I fail to export a dataframe produced by uco(seqinr) function in rscu computation. What means should I use?. The dataframe is not showing in r environment either, it only remain in the console. Have tried so much copying it to excel, word, notepad in vain. Could someone help?

...

ANSWER

Answered 2022-Apr-14 at 16:47

First of all, store the output of the function in a variable, e.g.:

Source https://stackoverflow.com/questions/71874756

QUESTION

Ignoring incomplete triplet in protein translation

Asked 2022-Mar-26 at 01:02

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

...

ANSWER

Answered 2022-Mar-26 at 00:31

You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):

Change

Source https://stackoverflow.com/questions/71624409

QUESTION

Data objects not found in embedded vegan:cca. Scoping issue?

Asked 2022-Mar-18 at 09:35

I try to embed cca (and also capscale) from package vegan (version 2.5-7, R 4.1.2) in another function to test an analysis pipeline with some data transformation and then varying model formulas. The used data matrices (e.g. bio and env) can have different names and are normally not visible in the global work space. The error that I get is:

...

ANSWER

Answered 2022-Mar-18 at 09:35

Yes, looks to be a scoping issue. I think the key is to update the formula's environment inside the function:

Source https://stackoverflow.com/questions/71524098

QUESTION

Endpoints Resolution Error - OAuth v2 Azure - msal-node

Asked 2022-Mar-11 at 05:59

I am trying to retrieve an OAuth v2 Token from Microsoft Azure to allow my API to access an SMTP Server (trying to implement Option 1 from here). I am attempting to use the msal-node library.

I've registered my API and have a token endpoint in the format:

const tokenEndpoint = https://login.microsoftonline.com/{{tenantID}}/oauth2/v2.0/token

I have the following code:

...

ANSWER

Answered 2022-Mar-11 at 05:59

Based on the documentation here, the authority endpoint should be https://login.microsoftonline.com/{{tenantID}}/.

Source https://stackoverflow.com/questions/71434059

QUESTION

Select argument doesn't work on cca objects

Asked 2022-Mar-06 at 16:38

I created an object of class cca in vegan and now I am trying to tidy up the triplot. However, I seemingly can't use the select argument to only show specified items. My code looks like this:

...

ANSWER

Answered 2022-Mar-04 at 15:30

The following code probably gives the result you want to achieve:

First, create an object to store the blank CCA1-CCA2 plot

Source https://stackoverflow.com/questions/71352817

QUESTION

ZMQ detect client unavailability with heartbeat

Asked 2022-Feb-22 at 20:16

I am experiencing with zmq, but I could not find an answer in the docs and examples that the proper use of the following socket options:

ZMQ_HEARTBEAT_IVL
ZMQ_HEARTBEAT_TIMEOUT
ZMQ_HEARTBEAT_TTL

The documentation states that they can be used with any socket types ("when using connection-oriented transports"). Is there a way to use them with REQ/REP socket pairs?

Test client code:

...

ANSWER

Answered 2022-Feb-22 at 20:16

Ok, so it looks like you need to use the zmq_socket_monitor() function. That causes the context to create itself a ZMQ_PAIR socket which it will bind to the endpoint you specify. You have to create your own ZMQ_PAIR socket, and connect it to that endpoint too.

You can read event messages from your ZMQ_PAIR socket (see the api reference for how these messages are formatted). So you can include that PAIR socket in a call to zmq_poll(), thus your application can be asynchronously informed when there is a change of status in the socket that you referred to in the zmq_socket_monitor() call.

The event that will be reported for a heartbeat timeout is, I think, ZMQ_EVENT_DISCONNECTED.

See here.

I'd say that, to get the most value out of this, you're pretty much obliged to use zmq_poll() (or similar). For example, a client expecting to receive messages can't be both blocked on a call to zmq_recv() from the socket connected to the server, and also blocked on the zmq_recv() from the monitor ZMQ_PAIR socket. Whereas if you're blocked on a call to zmq_poll() that's waiting for both the server and monitor sockets, then that'll return either when there is a message from the server, or some problem has arisen that means you're not going to get the message.

Source https://stackoverflow.com/questions/71224598

QUESTION

Variables not being reassigned in Loop

Asked 2022-Feb-19 at 04:55

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

...

ANSWER

Answered 2022-Feb-19 at 04:55

I did some refactoring. Can you try the following code?

Source https://stackoverflow.com/questions/71181881

QUESTION

Trying to get spaces between codons and stop the generation when reaching a certain codon for RNA to protein simulation

Asked 2022-Feb-11 at 00:21

Here's some things I need help with.
But first of all, please let me pull up the code first.

...

ANSWER

Answered 2022-Feb-11 at 00:21

Assuming you're trying to print everything prior to 'STOP' sliced into 3 characters each, here's an extension of your main function:

Source https://stackoverflow.com/questions/71073711

QUESTION

RNA to Protein simulation program's TypeErorr?

Asked 2022-Feb-10 at 00:47

Here's what I'm doing:

...

ANSWER

Answered 2022-Feb-10 at 00:00

I would first rewrite your

Source https://stackoverflow.com/questions/71058139

QUESTION

Iterating through dictionary lists with another list, and finding associated key of value

Asked 2022-Feb-04 at 22:09

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

...

ANSWER

Answered 2022-Feb-04 at 22:06

At the following line:

Source https://stackoverflow.com/questions/70993124

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install cca

You can download it from GitHub.
You can use cca like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at: