ccg | A Combinatory Categorial Grammar library | Code Quality library

 by   syllog1sm Python Version: Current License: No License

kandi X-RAY | ccg Summary

kandi X-RAY | ccg Summary

ccg is a Python library typically used in Code Quality applications. ccg has no bugs, it has no vulnerabilities and it has low support. However ccg build file is not available. You can download it from GitHub.

Manipulate Combinatory Categorial Grammar categories and derivations, for natural language processing research. The library is quite feature rich, but has a pretty messy API, and some bugs. The "killer feature" is the implementation of the CCG grammar rules and variable binding. After sentence.unify_vars() has been called, all categories will have all slots bound to "global" variables, which are unified to other variable bindings, and may have words attached.
Support
    Quality
      Security
        License
          Reuse

            kandi-support Support

              ccg has a low active ecosystem.
              It has 21 star(s) with 1 fork(s). There are 4 watchers for this library.
              OutlinedDot
              It had no major release in the last 6 months.
              There are 2 open issues and 0 have been closed. On average issues are closed in 1621 days. There are no pull requests.
              It has a neutral sentiment in the developer community.
              The latest version of ccg is current.

            kandi-Quality Quality

              ccg has 0 bugs and 0 code smells.

            kandi-Security Security

              ccg has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.
              ccg code analysis shows 0 unresolved vulnerabilities.
              There are 0 security hotspots that need review.

            kandi-License License

              ccg does not have a standard license declared.
              Check the repository for any license declaration and review the terms closely.
              OutlinedDot
              Without a license, all rights are reserved, and you cannot use the library in your applications.

            kandi-Reuse Reuse

              ccg releases are not available. You will need to build from source code and install.
              ccg has no build file. You will be need to create the build yourself to build the component from source.
              It has 3660 lines of code, 413 functions and 30 files.
              It has high code complexity. Code complexity directly impacts maintainability of the code.

            Top functions reviewed by kandi - BETA

            kandi has reviewed ccg and discovered the below as its top functions. This is intended to give you an instant insight into ccg implemented functionality, and help decide if they suit your requirements.
            • Return complex string representation of the result
            • Parse a complex string
            • Parse the atom string
            • Create a category from a string
            • Perform an operation on this node
            • Pretty print a node
            • Return the root node
            • Visit the given node
            • Return a string representation of the given sentence
            • Returns the ID line for the given sentence
            • Make a dep string
            • Write sentences to file
            • Return the path to the fileID
            • Return an iterator over all children of a specific section
            • Return the child with the given index
            • Run a test function
            • Yields all children of 2 to 2
            • Return an iterator over the sections of the section
            • Section sections
            • Generate all child sections
            Get all kandi verified functions for this library.

            ccg Key Features

            No Key Features are available at this moment for ccg.

            ccg Examples and Code Snippets

            No Code Snippets are available at this moment for ccg.

            Community Discussions

            QUESTION

            How do I export a dataframe produced by R?
            Asked 2022-Apr-14 at 16:47

            I fail to export a dataframe produced by uco(seqinr) function in rscu computation. What means should I use?. The dataframe is not showing in r environment either, it only remain in the console. Have tried so much copying it to excel, word, notepad in vain. Could someone help?

            ...

            ANSWER

            Answered 2022-Apr-14 at 16:47

            First of all, store the output of the function in a variable, e.g.:

            Source https://stackoverflow.com/questions/71874756

            QUESTION

            Update key name in a dictionary python
            Asked 2022-Mar-28 at 15:12

            I have the following fasta file in a dictionary, in the following shape:

            ...

            ANSWER

            Answered 2022-Mar-28 at 15:12

            Construct a new dictionary and then assign it to seq_dict in a single operation, rather than mutating seq_dict as you're in the process of iterating over it. I think this is what you're aiming for:

            Source https://stackoverflow.com/questions/71649626

            QUESTION

            Ignoring incomplete triplet in protein translation
            Asked 2022-Mar-26 at 01:02

            I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

            ...

            ANSWER

            Answered 2022-Mar-26 at 00:31

            You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):

            Change

            Source https://stackoverflow.com/questions/71624409

            QUESTION

            Ideal Height for Admob Native ads in Flutter(Medium size, not small)
            Asked 2022-Mar-08 at 16:21

            I am trying to show native ads in Flutter.

            https://codelabs.developers.google.com/codelabs/admob-inline-ads-in-flutter

            https://github.com/googlecodelabs/admob-inline-ads-in-flutter

            I used this codelab but they are showing small native ads.

            In fact, I successfully implemented their codelab in my Flutter project.

            But I want to make size medium, not small.

            https://developers.google.com/admob/ios/native/templates

            GADTSmallTemplateView(It seems this one, I don't want like small size)

            GADTMediumTemplateView(My aim is to make my native ads like this one)

            What is height in the codelab?

            ...

            ANSWER

            Answered 2022-Mar-08 at 16:21

            I summed height of all elements in the design. It was 308. Then, I think 310 will be an ideal number. No problem, when I make it 310. Everything seems good.

            Source https://stackoverflow.com/questions/71083085

            QUESTION

            Variables not being reassigned in Loop
            Asked 2022-Feb-19 at 04:55

            Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

            ...

            ANSWER

            Answered 2022-Feb-19 at 04:55

            I did some refactoring. Can you try the following code?

            Source https://stackoverflow.com/questions/71181881

            QUESTION

            defining the value for template in helm
            Asked 2022-Feb-11 at 00:52

            I have created a new helm project and directory structure looks like this as follows:

            ...

            ANSWER

            Answered 2022-Feb-10 at 17:46

            You can modify the payment.fullname template in _helpers.tpl like so:

            Source https://stackoverflow.com/questions/71064365

            QUESTION

            Trying to get spaces between codons and stop the generation when reaching a certain codon for RNA to protein simulation
            Asked 2022-Feb-11 at 00:21

            Here's some things I need help with.
            But first of all, please let me pull up the code first.

            ...

            ANSWER

            Answered 2022-Feb-11 at 00:21

            Assuming you're trying to print everything prior to 'STOP' sliced into 3 characters each, here's an extension of your main function:

            Source https://stackoverflow.com/questions/71073711

            QUESTION

            RNA to Protein simulation program's TypeErorr?
            Asked 2022-Feb-10 at 00:47

            Here's what I'm doing:

            ...

            ANSWER

            Answered 2022-Feb-10 at 00:00

            I would first rewrite your

            Source https://stackoverflow.com/questions/71058139

            QUESTION

            Iterating through dictionary lists with another list, and finding associated key of value
            Asked 2022-Feb-04 at 22:09

            I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

            I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

            I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

            Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

            I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

            Here is my code so far:

            ...

            ANSWER

            Answered 2022-Feb-04 at 22:06

            At the following line:

            Source https://stackoverflow.com/questions/70993124

            QUESTION

            Is there a way to translate a list of dna sequences into amino acids if the dna sequence is not divisible by three?
            Asked 2021-Oct-20 at 09:57

            I have been struggling with turning a list of DNA sequences into amino acid sequences. The function i wrote should read the DNA list in three nucleotides. It should loop over the sequences in the list and translate each sequence, using codons in a directory. Now I know that this problem isn't exactly new and that Biopython has a translation module made for that kind of stuff. The difficulty lies in that I later want to use a degenerate codon directory, with an NNK-codon code (K being G or T) and as far as my research went there is no possibility to make custom codon dics with Biopython. Also the DNA sequences that I use aren't uniform in length.

            Now I think it's time to go a little more in depth and explain where my data aka. the list of DNA sequences is coming from. The sequences (ranging from a couple 1000 to more than 1 million) are random nucleotides in between to markers that I isolated via a function using a regex search written to a text file. The structure of this file looks like this:

            CACCAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGTCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGATGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CAGCATTAGGAGCCGGCTGATGAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGTGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC

            What i tried is to read in the file and get a list of all sequences as strings, get rid of whitespaces and newline breaks and that kind of stuff. Start a function in which the codon usage is defined and loop over the list of sequences for each sequence in a three letter fashion, translating them to the amino acid defined by the codon in the dict.

            Code I got so far:

            ...

            ANSWER

            Answered 2021-Oct-20 at 09:17

            Community Discussions, Code Snippets contain sources that include Stack Exchange Network

            Vulnerabilities

            No vulnerabilities reported

            Install ccg

            You can download it from GitHub.
            You can use ccg like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.

            Support

            For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .
            Find more information at:

            Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items

            Find more libraries
            CLONE
          • HTTPS

            https://github.com/syllog1sm/ccg.git

          • CLI

            gh repo clone syllog1sm/ccg

          • sshUrl

            git@github.com:syllog1sm/ccg.git

          • Stay Updated

            Subscribe to our newsletter for trending solutions and developer bootcamps

            Agree to Sign up and Terms & Conditions

            Share this Page

            share link

            Explore Related Topics

            Consider Popular Code Quality Libraries

            prettier

            by prettier

            yapf

            by google

            ReflectionDocBlock

            by phpDocumentor

            Numeral-js

            by adamwdraper

            languagetool

            by languagetool-org

            Try Top Libraries by syllog1sm

            redshift

            by syllog1smPython

            cython-sparsehash

            by syllog1smC++

            swbd_tools

            by syllog1smPython

            bracket_eager

            by syllog1smPython

            sundry

            by syllog1smPython