ccg | based code generation tool | Generator Utils library

I have the following fasta file in a dictionary, in the following shape:

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

I am trying to show native ads in Flutter.

https://codelabs.developers.google.com/codelabs/admob-inline-ads-in-flutter

https://github.com/googlecodelabs/admob-inline-ads-in-flutter

I used this codelab but they are showing small native ads.

In fact, I successfully implemented their codelab in my Flutter project.

But I want to make size medium, not small.

https://developers.google.com/admob/ios/native/templates

GADTSmallTemplateView(It seems this one, I don't want like small size)

GADTMediumTemplateView(My aim is to make my native ads like this one)

What is height in the codelab?

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

I have created a new helm project and directory structure looks like this as follows:

Here's some things I need help with.
But first of all, please let me pull up the code first.

Here's what I'm doing:

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

I have been struggling with turning a list of DNA sequences into amino acid sequences. The function i wrote should read the DNA list in three nucleotides. It should loop over the sequences in the list and translate each sequence, using codons in a directory. Now I know that this problem isn't exactly new and that Biopython has a translation module made for that kind of stuff. The difficulty lies in that I later want to use a degenerate codon directory, with an NNK-codon code (K being G or T) and as far as my research went there is no possibility to make custom codon dics with Biopython. Also the DNA sequences that I use aren't uniform in length.

Now I think it's time to go a little more in depth and explain where my data aka. the list of DNA sequences is coming from. The sequences (ranging from a couple 1000 to more than 1 million) are random nucleotides in between to markers that I isolated via a function using a regex search written to a text file. The structure of this file looks like this:

CACCAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGTCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGATGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CAGCATTAGGAGCCGGCTGATGAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGTGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC

What i tried is to read in the file and get a list of all sequences as strings, get rid of whitespaces and newline breaks and that kind of stuff. Start a function in which the codon usage is defined and loop over the list of sequences for each sequence in a three letter fashion, translating them to the amino acid defined by the codon in the dict.

Code I got so far: