uaa | CloudFoundry User Account and Authentication Server | OAuth library
kandi X-RAY | uaa Summary
kandi X-RAY | uaa Summary
The UAA is a multi tenant identity management service, used in Cloud Foundry, but also available as a stand alone OAuth2 server. Its primary role is as an OAuth2 provider, issuing tokens for client applications to use when they act on behalf of Cloud Foundry users. It can also authenticate users with their Cloud Foundry credentials, and can act as an SSO service using those credentials (or others). It has endpoints for managing user accounts and for registering OAuth2 clients, as well as various other management functions.
Support
Quality
Security
License
Reuse
Top functions reviewed by kandi - BETA
- Confirm an access to the user
- Returns a list of scopes
- Returns the redirect uri
- Extracts the user id from an Authentication
- Create an access token
- Creates a new refresh token
- Build JWT token
- Extract additional authorization attributes from the request
- Invite an invitation
- Performs authentication
- Deserialize UaaAuthentication details
- Handle an enterprise invitation
- Authentication with the given access token
- Retrieve an access token based on the refresh token
- Invoked to begin the OAuth authorization flow
- This method checks the Authorization header and returns the clientId
- Performs database migration
- Initializes identity zone configuration
- Perform SAML authentication
- Returns true if the user was approved
- Handles an OAuth authorization request
- Deserialize a ScrimUser
- Sets identity providers
- Accepts an invite page
- Gets the external authentication details
- Converts a string into UAA data
uaa Key Features
uaa Examples and Code Snippets
Lines of Code : 29License : Permissive (MIT License)
Copypublic HttpServletRequest refreshToken(HttpServletRequest request, HttpServletResponse response, Cookie
refreshCookie) {
//check if non-remember-me session has expired
if (cookieHelper.isSessionExpired(refreshCookie)) {
public ResponseEntity authenticate(HttpServletRequest request, HttpServletResponse response,
Map params) {
try {
String username = params.get("username");
Strin @Override
public SignatureVerifier getSignatureVerifier() throws Exception {
try {
HttpEntity request = new HttpEntity(new HttpHeaders());
String key = (String) restTemplate
.exchange(getPublicKeyEn Community Discussions
Trending Discussions on uaa
QUESTION
Here's some things I need help with.
But first of all, please let me pull up the code first.
ANSWER
Answered 2022-Feb-11 at 00:21Assuming you're trying to print everything prior to 'STOP' sliced into 3 characters each, here's an extension of your main function:
QUESTION
Here's what I'm doing:
...ANSWER
Answered 2022-Feb-10 at 00:00I would first rewrite your
QUESTION
I have a string like rna = "UACGAUGUUUCGGGAAUGCCUAAAUGUUCCGGCUGCUAA" and I want to iterate through the string and capture the different strings which start with 'AUG' and with 'UAA' or 'UAG' or 'UGA'.
This is the code I've written so far:
...ANSWER
Answered 2022-Jan-05 at 12:32The problem in this line of code:
QUESTION
I'm trying to build a simple Discord bot which finds information about a specific stock when its name or symbol is inputted by the user. I included my code which web-scraped all the data into another document, but it's included in my bot.py file. I have it set up so that when I type viewall, a list of all the stocks should appear. However, when typing that command in my Discord server, I get nothing. However, the output on my terminal is:
ANSWER
Answered 2021-Dec-31 at 04:09This is just my guess, but maybe variable response is not detected as a string. What you may want to try:
QUESTION
I web-scraped some information about S&P 500 stocks from this website: https://www.slickcharts.com/sp500. The actual web-scraping bit works fine, as if I add a print statement after the for loop included, all data is displayed. In other words, the code:
...ANSWER
Answered 2021-Dec-25 at 03:07Because you keep reassigning company, symbol, weight, etc. on each iteration, these variables only hold the values from the last row you parsed.
You can use pd.read_html instead. It returns a list of data frames, one for each
soup.findQUESTION
Gekko is not respecting the restrictions, and because of that is not being able to find the same solutions as excel solver for example.
Here is the problem to solve, a minimization of errors
...ANSWER
Answered 2021-Nov-14 at 13:49The script gives a solution that is within the bounds -0.005<0.005 for all variables. One potential reason that the bounds are not observed is that the solver failed to find a solution. Switching to disp=True displays the solver output to ensure that a successful solution is found.
QUESTION
I am trying to familiarize myself with Spring Security, in particular migrating from Spring Security OAuth to Soring Security (as in the following example/guide https://github.com/spring-projects/spring-security/wiki/OAuth-2.0-Migration-Guide).
However, I am seeming to only get 403 Forbidden errors. I am accessing from Postman and am using my company's existing OAuth server. I am able to get a token from the auth server, so I know I have those credentials correct and I have verified what roles the OAuth user has.
I am using the following dependencies:
...ANSWER
Answered 2021-Oct-27 at 02:15There may be a couple of things happening.
As you're migrating to Spring Security 5, you may need to extract your authorities manually. Check this post and it's correct answer.
You are using hasRole function and this will append "ROLE_" before your authority/role. So if the role on your JWT token is not ROLE_JWT_ROLE you should use hasTransaction.
QUESTION
I am currently running a Java Spring Boot program that should return a response that includes two Excel files (.xlsx) as ByteArrayOutputStream's in the ServletOutputStream as Content-Disposition: attachment;
However, upon returning that response to chrome, it isn't downloading anything.
The Excel files are generated using the Apache POI and then they're being written to a ByteArrayOutputStream.
Here's my code on the file generation
...ANSWER
Answered 2021-Sep-12 at 13:50You are returning multiple files directly. To respond multiple file compress them and send them as zip file. Also in the code you are first setting the content type and then updating the contentType.
QUESTION
Am learning python and one of the questions in our study guide asks to evaluate RNA sequences. I do not get the expected outputs as suggested by the question, I get 17.
Here is the code:
...ANSWER
Answered 2021-Aug-24 at 14:17The issue is you using the boolean operator or to compare strings. You can think of the comparisons like this:
QUESTION
I'm new in using ansible for automation, I am trying to check if user's account is existing on the manage hosts or not. The situation is, when the user account is existing the results will register to the stdout but when not it will display on the stderr. I am using a debug module to display the result. I want to ask how to filter the results like when user account is existing, it will only display the stdout debug function, and when its not, it will only display the stderr function. Tried checking every page i know but cant find a resolution. Thanks in advance,
Code:
...ANSWER
Answered 2021-Aug-13 at 13:52Use when statement to validate if stdout is empty or not. Try as below.
Community Discussions, Code Snippets contain sources that include Stack Exchange Network
Vulnerabilities
No vulnerabilities reported
Install uaa
Java 11
Support
Reuse Trending Solutions
Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items
Find more librariesStay Updated
Subscribe to our newsletter for trending solutions and developer bootcamps
Share this Page
