kandi background

motif | Scala-like pattern matching for Java | Functional Programming library

by johnlcox Java Version: 0.1 License: Apache-2.0

by johnlcox Java Version: 0.1 License: Apache-2.0

kandi X-RAY | motif Summary

motif is a Java library typically used in Programming Style, Functional Programming, Example Codes applications. motif has no bugs, it has no vulnerabilities, it has build file available, it has a Permissive License and it has high support. You can download it from GitHub, Maven.

A pattern matching library for Java 8. Motif provides scala-like pattern matching in Java 8.

Support

Support

Quality

Quality

Security

Security

License

License

Reuse

Reuse

kandi-support Support

motif has a highly active ecosystem.
It has 149 star(s) with 5 fork(s). There are 13 watchers for this library.
It had no major release in the last 12 months.
There are 4 open issues and 5 have been closed. On average issues are closed in 10 days. There are no pull requests.
It has a negative sentiment in the developer community.
The latest version of motif is 0.1

motif Support

Best in #Functional Programming

Average in #Functional Programming

motif Support

Best in #Functional Programming

Average in #Functional Programming

quality kandi Quality

motif has no bugs reported.

motif Quality

Best in #Functional Programming

Average in #Functional Programming

motif Quality

Best in #Functional Programming

Average in #Functional Programming

security Security

motif has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

motif Security

Best in #Functional Programming

Average in #Functional Programming

motif Security

Best in #Functional Programming

Average in #Functional Programming

license License

motif is licensed under the Apache-2.0 License. This license is Permissive.
Permissive licenses have the least restrictions, and you can use them in most projects.

motif License

Best in #Functional Programming

Average in #Functional Programming

motif License

Best in #Functional Programming

Average in #Functional Programming

build Reuse

motif releases are not available. You will need to build from source code and install.
Deployable package is available in Maven.
Build file is available. You can build the component from source.
Installation instructions, examples and code snippets are available.

motif Reuse

Best in #Functional Programming

Average in #Functional Programming

motif Reuse

Best in #Functional Programming

Average in #Functional Programming

Top functions reviewed by kandi - BETA

kandi has reviewed motif and discovered the below as its top functions. This is intended to give you an instant insight into motif implemented functionality, and help decide if they suit your requirements.

Returns the Javadoc comment for the two types .

Generate the code .

Creates a list of type names .

Perform a decomposition on the first and second .

Recursively builds a list of nested matchers .

Unapply the given tuple to this tuple .

Runs the stand alone .

Performs a decomposable decomposition on the first index .

Fizzbuzz benchmark .

Returns the match indexes between two types .

Get all kandi verified functions for this library.

Get all kandi verified functions for this library.

motif Key Features

Scala-like pattern matching for Java 8

motif Examples and Code Snippets

Community Discussions

Trending Discussions on motif

Create a list that represents all the possible paths an individual can take
Problem with checkbox in DataGridTemplateColumn
Find Word Count"- My code doesn't work properly
How to use awk to search for strings in a while read loop
How to associate two lists or columns?
How to get unique values/elements of a column?
Why am I getting uneven vertical padding in a Motif Widget List?
Creating an option menu in Motif
Generating strings of length l with hamming distance d
TFBS search with TFBSTools and a for loop

Trending Discussions on motif

QUESTION

Create a list that represents all the possible paths an individual can take

Asked 2021-Jun-01 at 12:41

The below dataframe represents presumed residence of a set of individuals:

import pandas as pd

df = pd.DataFrame({'PRESUMED_RESIDENCE':['SJDR1', 'LD1', 'LD2', 'TR1', 'TR2', 'SVM']})
df

I need to create a list that contains all the possible trajectories that an individual can take - here I will call these trajectories motifs -. Below is an example of the list I expect as a final result:

MOTIFS = [[SJDR1],[LD1],[LD2], [TR1], [TR2], [SVM], [SJDR1,LD1], [SJDR1,LD2], [SJDR1,TR1],
[SJDR1,TR2], [SJDR1,SVM], [SJDR1, TR1, TR2].....[SJDR1,LD1,LD2,TR1,TR2,SVM]

With this list and the complete dataframe I can find patterns of mobility of individuals, seeing which trajectories are the most repeated. However, I have no idea how I can generate this list. Can anyone help?

ANSWER

Answered 2021-Jun-01 at 12:41

Use more_itertools.powerset which will result in list of tuples so convert it into list of list using map()

import more_itertools
vals = df["PRESUMED_RESIDENCE"].to_list()
out = list(more_itertools.powerset(vals))[1:]
MOTIFS = list(map(list, out))

print(MOTIFS)

>> [['SJDR1'],
 ['LD1'],
 ['LD2'],
 ['TR1'],
 ['TR2'],
 ['SVM'],
 ['SJDR1', 'LD1'],
 ['SJDR1', 'LD2'],
 ['SJDR1', 'TR1'],
 ['SJDR1', 'TR2'],
 ['SJDR1', 'SVM'],
 ['LD1', 'LD2'],
 ['LD1', 'TR1'],
 ['LD1', 'TR2'],
 ['LD1', 'SVM'],
 ['LD2', 'TR1'],
 ['LD2', 'TR2'],
 ['LD2', 'SVM'],
 ['TR1', 'TR2'],
 ['TR1', 'SVM'],
 ['TR2', 'SVM'],
 ['SJDR1', 'LD1', 'LD2'],
 ['SJDR1', 'LD1', 'TR1'],
 ['SJDR1', 'LD1', 'TR2'],
 ['SJDR1', 'LD1', 'SVM'],
 ['SJDR1', 'LD2', 'TR1'],
 ['SJDR1', 'LD2', 'TR2'],
 ['SJDR1', 'LD2', 'SVM'],
 ['SJDR1', 'TR1', 'TR2'],
 ['SJDR1', 'TR1', 'SVM'],
 ['SJDR1', 'TR2', 'SVM'],
 ['LD1', 'LD2', 'TR1'],
 ['LD1', 'LD2', 'TR2'],
 ['LD1', 'LD2', 'SVM'],
 ['LD1', 'TR1', 'TR2'],
 ['LD1', 'TR1', 'SVM'],
 ['LD1', 'TR2', 'SVM'],
 ['LD2', 'TR1', 'TR2'],
 ['LD2', 'TR1', 'SVM'],
 ['LD2', 'TR2', 'SVM'],
 ['TR1', 'TR2', 'SVM'],
 ['SJDR1', 'LD1', 'LD2', 'TR1'],
 ['SJDR1', 'LD1', 'LD2', 'TR2'],
 ['SJDR1', 'LD1', 'LD2', 'SVM'],
 ['SJDR1', 'LD1', 'TR1', 'TR2'],
 ['SJDR1', 'LD1', 'TR1', 'SVM'],
 ['SJDR1', 'LD1', 'TR2', 'SVM'],
 ['SJDR1', 'LD2', 'TR1', 'TR2'],
 ['SJDR1', 'LD2', 'TR1', 'SVM'],
 ['SJDR1', 'LD2', 'TR2', 'SVM'],
 ['SJDR1', 'TR1', 'TR2', 'SVM'],
 ['LD1', 'LD2', 'TR1', 'TR2'],
 ['LD1', 'LD2', 'TR1', 'SVM'],
 ['LD1', 'LD2', 'TR2', 'SVM'],
 ['LD1', 'TR1', 'TR2', 'SVM'],
 ['LD2', 'TR1', 'TR2', 'SVM'],
 ['SJDR1', 'LD1', 'LD2', 'TR1', 'TR2'],
 ['SJDR1', 'LD1', 'LD2', 'TR1', 'SVM'],
 ['SJDR1', 'LD1', 'LD2', 'TR2', 'SVM'],
 ['SJDR1', 'LD1', 'TR1', 'TR2', 'SVM'],
 ['SJDR1', 'LD2', 'TR1', 'TR2', 'SVM'],
 ['LD1', 'LD2', 'TR1', 'TR2', 'SVM'],
 ['SJDR1', 'LD1', 'LD2', 'TR1', 'TR2', 'SVM']]

Source https://stackoverflow.com/questions/67788862

QUESTION

Problem with checkbox in DataGridTemplateColumn

Asked 2021-May-27 at 19:26

I need help to finish my first little app. I'm trying to do action for checked's rows in a datagrid.

the xaml :

                <DataGrid x:Name="dgConnected_Users" AutoGenerateColumns="False" IsReadOnly="True" Height="180" Background="Azure" ScrollViewer.CanContentScroll="True" FontSize="11" BorderBrush="#26BFF0" ScrollViewer.HorizontalScrollBarVisibility="Disabled" HorizontalScrollBarVisibility="Disabled" BorderThickness="2,2,2,2" HeadersVisibility="Column" CanUserAddRows="False" CanUserDeleteRows="False" CanUserResizeRows="False" RowHeight="20" RowBackground="Azure" GridLinesVisibility="Horizontal" HorizontalGridLinesBrush="DarkOrange" Margin="10,0,10,0">
                <DataGrid.Columns>
                    <DataGridTextColumn x:Name="UID_UserName" FontFamily="Segoe UI Bold" Binding="{Binding UID_UserName}" Header="Utilisateur" Width="1*">
                        <DataGridTextColumn.ElementStyle>
                            <Style TargetType="TextBlock">
                                <Setter Property="VerticalAlignment" Value="Center"></Setter>
                                <Setter Property="Margin" Value="5,0"></Setter>
                            </Style>
                        </DataGridTextColumn.ElementStyle>
                    </DataGridTextColumn>
                    <DataGridTextColumn x:Name="UID_ComputerName" Binding="{Binding UID_ComputerName}" Header="Machine" Width="1*">
                        <DataGridTextColumn.ElementStyle>
                            <Style TargetType="TextBlock">
                                <Setter Property="VerticalAlignment" Value="Center"></Setter>
                                <Setter Property="Margin" Value="5,0"></Setter>
                            </Style>
                        </DataGridTextColumn.ElementStyle>
                    </DataGridTextColumn>
                    <DataGridTemplateColumn x:Name="UID_Chkbox" Width="24">
                        <DataGridTemplateColumn.CellTemplate>
                            <DataTemplate>
                                <TextBlock TextAlignment="Center" VerticalAlignment="Center"><CheckBox x:Name="Chk_UID_IsSelected" IsChecked="{Binding IsChecked, UpdateSourceTrigger=PropertyChanged, Mode=TwoWay}" Checked="Chk_UID_IsSelected_Checked" Unchecked="Chk_UID_IsSelected_Unchecked" Click="Chk_UID_IsSelected_Click"/></TextBlock>
                            </DataTemplate>
                        </DataGridTemplateColumn.CellTemplate>
                        <DataGridTemplateColumn.Header>
                            <Image Source="components/resources/images/delete-24.png" Height="12" Width="12" StretchDirection="Both" Stretch="Fill"/>
                        </DataGridTemplateColumn.Header>
                    </DataGridTemplateColumn>
                </DataGrid.Columns>
            </DataGrid>
            <StackPanel Margin="10,10">
                <Button x:Name="UID_Disconnect" Width="270" Click="UID_Disconnect_Click">Déconnecter le(s) utilisateur(s)</Button>
            </StackPanel>
            <StackPanel Margin="10,0">
                <Grid>
                    <Border BorderBrush="#26BFF0" BorderThickness="0,1,0,0">
                        <TextBlock HorizontalAlignment="Center" FontFamily="Segoe UI Light" FontSize="10" Padding="5" Foreground="#FF4C4F54">InovaGes SAS · Développé par Fabrice BERTRAND</TextBlock>
                    </Border>
                </Grid>
            </StackPanel>

The xaml.cs :

    private void UID_Disconnect_Click(object sender, RoutedEventArgs e)
    {
        /// gestion de la déconnexion des utilisateurs au clic du bouton 'UID_Disconnect'
        /// 
        IEnumerable<CheckBox> UsersInDatabase = dgConnected_Users.Items.OfType<CheckBox>().Where(usr => usr.IsChecked == true);

        foreach (CheckBox usr in UsersInDatabase)
        {

            MessageBox.Show("yeah"); /// do stuff here
        }
    }

I'm testing the code with a MessageBox for now. But nothing happen. An idea to help me to finish my project ?

In fact, I need for each row where checkbox is checked to get the UID_UserName to do a sql delete.

I have tried with DataRowView too. I can get TextColumn but nothing with checkbox.

Edit 1 :

I think a part of the problem is due that the column with checkbox is not in the dt :

        private void refresh_Click(object sender, RoutedEventArgs e)
    {
        try
        {
            if (Cnx.State == System.Data.ConnectionState.Open)
            {
                Cnx.Close();
            }
            if (cmbAuthentification.Text.Equals("Windows"))
            {
                SQL_Connection.ConnectionString = @"Server = " + txtServerName.Text + "; Integrated Security = SSPI;";
                Cnx.ConnectionString = SQL_Connection.ConnectionString;
            }
            else if (cmbAuthentification.Text.Equals("SQL Server"))
            {
                SQL_Connection.ConnectionString = @"Server = " + txtServerName.Text + "; User ID =" + txtUserID.Text + "; Password=" + txtUserPwd.Password + ";";
                Cnx.ConnectionString = SQL_Connection.ConnectionString;
            }
            Cnx.Open();
            Cmd.Connection = Cnx;
            Cmd.CommandText = ("USE \"" + cmbDatabase.Text + "\";SELECT DISTINCT b.nt_username AS [UID_UserName], b.hostname AS [UID_ComputerName] FROM cbUserSession a INNER JOIN master..sysprocesses b ON a.cbSession = b.spid WHERE a.cbUserName IS NOT NULL;");
            SqlDataAdapter da = new SqlDataAdapter(Cmd);
            dt = new DataTable("Connected_Users");
            da.Fill(dt);
            /// dt.Columns.Add(new DataColumn("IsChecked", typeof(bool))); <-- maybe need to do something like that ?
            dgConnected_Users.ItemsSource = dt.DefaultView;
            Cnx.Close();
        }
        catch (Exception exception)
        {
            MessageBox.Show("Erreur de chargement des données pour le motif suivant : \n" + exception.Message, "OOoopssss !!!", MessageBoxButton.OK, MessageBoxImage.Error);
        }
    }

ANSWER

Answered 2021-May-25 at 07:47

I had constructed the rest of the code in order to show you the working copy.

I assume you have a class object which you are binding as an items source to data-grid. FYI, I have created my own class object. See below and change as per your class file.

Step 1 - Class creation

public class DataGridUser
{
    public string UID_UserName { get; set; }

    public string UID_ComputerName { get; set; }

    public bool IsChecked { get; set; }
}

Step 2 - On button click, I just modified the code as below.

private void UID_Disconnect_OnClick(object sender, RoutedEventArgs e)
    {
        var selectedItems = dgConnected_Users.Items.Cast<DataGridUser>().Where(x => x.IsChecked);

        foreach (var item in selectedItems)
        {
            MessageBox.Show(item.UID_ComputerName + " " + item.UID_UserName);
        }
    }

In above code, I have used the "Cast" type and casting the item to the type that data grid is bound to which is DataGridUser (in this case).

Rest of the code is same as yours.

Edit Added code to answer your comment.

Step 3 I have copied your event handler and then made slight change. Please compare the code and read comments carefully and then use it in your program.

private void refresh_Click(object sender, RoutedEventArgs e)
{
    try
    {
        if (Cnx.State == System.Data.ConnectionState.Open)
        {
            Cnx.Close();
        }
        if (cmbAuthentification.Text.Equals("Windows"))
        {
            SQL_Connection.ConnectionString = @"Server = " + txtServerName.Text + "; Integrated Security = SSPI;";
            Cnx.ConnectionString = SQL_Connection.ConnectionString;
        }
        else if (cmbAuthentification.Text.Equals("SQL Server"))
        {
            SQL_Connection.ConnectionString = @"Server = " + txtServerName.Text + "; User ID =" + txtUserID.Text + "; Password=" + txtUserPwd.Password + ";";
            Cnx.ConnectionString = SQL_Connection.ConnectionString;
        }
        Cnx.Open();
        Cmd.Connection = Cnx;
        Cmd.CommandText = ("USE \"" + cmbDatabase.Text + "\";SELECT DISTINCT b.nt_username AS [UID_UserName], b.hostname AS [UID_ComputerName] FROM cbUserSession a INNER JOIN master..sysprocesses b ON a.cbSession = b.spid WHERE a.cbUserName IS NOT NULL;");
        
        //SqlDataAdapter da = new SqlDataAdapter(Cmd);
        //dt = new DataTable("Connected_Users");
        //da.Fill(dt);
        // dt.Columns.Add(new DataColumn("IsChecked", typeof(bool))); <-- maybe need to do something like that ?

        // GK - Instead of using SqlDataAdapter. Use DataReader and transfer the data from DataReader to an object. See below.
            SqlDataReader reader = Cmd.ExecuteReader();
            var dataGridUserCollection = new List<DataGridUser>();

            if (reader.HasRows)
            {
                while (reader.Read())
                {
                    var currentDataGridUser = new DataGridUser()
                    {
                        UID_UserName = reader["UID_UserName"].ToString(),
                        UID_ComputerName = reader["UID_ComputerName"].ToString()
                    };

                    dataGridUserCollection.Add(currentDataGridUser);
                }
            }

            // GK - Bind new list object to DataGrid.
            // GK - Now the object bound to DataGrid is of type DataGridUser.
            // GK - So now when you do the type casting to DataGridUser on your button click
            // it won't throw any more error.

            //dgConnected_Users.ItemsSource = dt.DefaultView;
            dgConnected_Users.ItemsSource = dataGridUserCollection; 
            
        Cnx.Close();
    }
    catch (Exception exception)
    {
        MessageBox.Show("Erreur de chargement des données pour le motif suivant : \n" + exception.Message, "OOoopssss !!!", MessageBoxButton.OK, MessageBoxImage.Error);
    }
}

Note:- I assume that the columns are of type string and then converting them to a string. You should take care of this minimum things before you run your code.

Let us know in case if you still face any problems.

Source https://stackoverflow.com/questions/67668890

QUESTION

Find Word Count"- My code doesn't work properly

Asked 2021-May-25 at 17:41

"Find Word Count"- Instructions: Given an input string (assume it's essentially a paragraph of text) and a word to find, return the number of times in the input string that the word is found. Should be case agnostic and remove space, commas, full stops, quotes, tabs etc while finding the matching word.

=======================

My code doesn't work properly.

`
String input = " It can hardly be a coincidence that no language on" +
                " Earth has ever produced the expression as pretty as an airport." +
                " Airports are ugly. Some are very ugly. Some attain a degree of ugliness" +
                " that can only be the result of a special effort. This ugliness arises " +
                "because airports are full of people who are tired, cross, and have just " +
                "discovered that their luggage has landed in Murmansk (Murmansk airport " +
                "is the only known exception to this otherwise infallible rule), and architects" +
                " have on the whole tried to reflect this in their designs. They have sought" +
                " to highlight the tiredness and crossness motif with brutal shapes and nerve" +
                " jangling colors, to make effortless the business of separating the traveller" +
                " for ever from his or her luggage or loved ones, to confuse the traveller with" +
                " arrows that appear to point at the windows, distant tie racks, or the current " +
                "position of Ursa Minor in the night sky, and wherever possible to expose the " +
                "plumbing on the grounds that it is functional, and conceal the location of the" +
                "departure gates, presumably on the grounds that they are not.";
        input = input.toLowerCase();
        String whichWord = "be";
        whichWord = whichWord.toLowerCase();
        int lastIndex = 0;
        int count = 0;

        while(lastIndex != -1){

            lastIndex = input.indexOf(whichWord,lastIndex);

            if(lastIndex != -1){
                count ++;
                lastIndex += whichWord.length();
            }
        }
        System.out.println(count);
`

ANSWER

Answered 2021-May-25 at 17:41

In your code you are not checking complete word. So, its matching both 'be' and 'because'. You're checking if there are any sub-strings contains the word 'be'. Could you please try below solution using regex? It will solve your purpose:

import java.util.regex.Matcher;
import java.util.regex.Pattern;

public class WordCount {

    public static void main(String[] args) {
        String input = " It can hardly be a coincidence that no language on" +
                " Earth has ever produced the expression as pretty as an airport." +
                " Airports are ugly. Some are very ugly. Some attain a degree of ugliness" +
                " that can only be the result of a special effort. This ugliness arises " +
                "because airports are full of people who are tired, cross, and have just " +
                "discovered that their luggage has landed in Murmansk (Murmansk airport " +
                "is the only known exception to this otherwise infallible rule), and architects" +
                " have on the whole tried to reflect this in their designs. They have sought" +
                " to highlight the tiredness and crossness motif with brutal shapes and nerve" +
                " jangling colors, to make effortless the business of separating the traveller" +
                " for ever from his or her luggage or loved ones, to confuse the traveller with" +
                " arrows that appear to point at the windows, distant tie racks, or the current " +
                "position of Ursa Minor in the night sky, and wherever possible to expose the " +
                "plumbing on the grounds that it is functional, and conceal the location of the" +
                "departure gates, presumably on the grounds that they are not.";

        input = input.toLowerCase();
        String whichWord = "be";
        whichWord = whichWord.toLowerCase();

        int count = 0;
        String regex = "(\\W|^)" + whichWord + "(\\W|$)";
        Pattern pattern = Pattern.compile(regex, Pattern.CASE_INSENSITIVE);
        Matcher matcher = pattern.matcher(input);

        while(matcher.find()) {
            count++;
        }

        System.out.println(count);
    }

}

Source https://stackoverflow.com/questions/67692527

QUESTION

How to use awk to search for strings in a while read loop

Asked 2021-May-12 at 16:12

I would like to loop through file1, which has two columns. Each column has a string that I would like to use to search in a dataframe file (file2) with 18 columns. I'd like to select rows from file2 that have both strings from file1 in two different columns to create a new file.

file1 (tab separated file with about 150 rows, it has no header)

#region      motif
Exon         ATG
Exon         CTG
5' UTR       GCC
3' UTR       GGC

file2 (tab separated file with about 1.5 million rows - has a header) There are 18 columns. Column 18 has the region information from file1, and column 15 has the motif information from file 1.

chr start   end period  copyNum consensusSize   perMatch    perIndel    score   A   C   G   T   entropy motif   sequence    ID  region
chr1    15798   15822   3   8.3 3   77  0   29  0   40  20  40  1.52    TGC TGCTCCTGCTCCTTCTGCTGCTGCT   chr1_15798_15822_TGC    Exon
chr9    140196426   140196441   3   5.3 3   84  0   25  0   31  62  6   1.2 GGC GGCGGCGGCTGCGGCG    chr9_140196426_140196441_GGC    5' UTR
chr1    19282560    19282579    3   6.7 3   76  0   26  5   40  25  30  1.77    CTG CTGCTGCTGCTCCAGCTGCT    chr1_19282560_19282579_CTG  Exon
chr8    131028679   131028694   3   5.3 3   100 0   32  0   62  37  0   0.95    GCC GCCGCCGCCGCCGCCG    chr8_131028679_131028694_GCC    5' UTR

The expected output is to include all columns from file2, but only rows that match file 1 on both strings. From the example, rows 3 and 4 from file2 should be in the output.

When I do it manually without going through the loop, it works fine. But once it's in the loop I get an empty output file. This is what I have tried so far:

while read REGION MOTIF; do
       awk '$18 == "'${REGION}'" && $15 == "'${MOTIF}'"' file2 >> output.txt
done < file1.txt

I get the following errors:
awk: cmd. line:1: ($18 == "Exon" && $15 == "CAG
awk: cmd. line:1:                          ^ unterminated string
awk: cmd. line:1: ($18 == "5'" && $15 == "UTR
awk: cmd. line:1:                        ^ unterminated string

Also tried the following with no error but empty output file:

while read REGION MOTIF; do
       awk -v a="$REGION" -v b="$MOTIF" '($18 == a && $15 == b)' file2.txt >> output.txt
done < file1.txt

If I do a single line in the command line, it works. So it's something to do with how the region and motif variables are being passed into awk I believe. The ones that don't work manually are the 5' UTR and 3' UTR, since they have the single quote I guess.

awk '($18 == "Exon" && $15 == "CTG")' file2.txt > output.txt

or

awk -v a="Exon" -v b="CAG" '($18 == a && $15 == b)' file2.txt > output.txt

ANSWER

Answered 2021-May-12 at 15:22

You may try this awk that stores all value from 1st column in region array and 2nd column in motif array while going through file1. Later we print records from file2 if $18 is found in region array and $15 is found in motif array:

awk -F'\t' 'NR==FNR {region[$1]; motif[$2]; next}
$18 in region && $15 in motif' file1 file2

Output:

chr1    15798   15822   3   8.3 3   77  0   29  0   40  20  40  1.52    CTG TGCTCCTGCTCCTTCTGCTGCTGCT   chr1_15798_15822_TGC    Exon

Source https://stackoverflow.com/questions/67506169

QUESTION

How to associate two lists or columns?

Asked 2021-Apr-29 at 16:59

Code/Program:

    # 1. Represent all unique feature types (column 2).

    lines = f.read().split('\n')

    # Set features

    unique_features = set((i.split('\t')[1]) for i in lines)
    unique_features = sorted(unique_features)
    qty_features = [str(i.split('\t')[1]) for i in lines]

for feature in unique_features:
    print(feature, qty_features.count(feature))


# 2. For every feature type (column 2) it stores all feature names (column 4) that had that type.

# Create a list of types and names

types = list(unique_features)
names = list([str(i.split('\t')[3]) for i in lines])

data = dict()

for i in range(len(types)):
    data[types[i]] = names[i]

print(data)

I have the problem in the code that is after the comment:

"# 2. Demonstrate the use of a data structure that associates the feature names to feature types".

I am trying to get the data in column # 4 of the file that is associated to column # 2.

DESIRED OUTPUT:

For each Feature Type (column 2), I would like to get all the Feature Names (column 4) that are associated with the Feature Types.

{'ORF': ['YAL069W', 'YAL068W-A', 'YAL068C', 'YAL067W-A' ... ] }
{'CDS': ['YAL068W-A', 'YAL068C', 'YAL067W-A', 'YAL067C' ... ] }

And that with all the unique values in column 2:

(ARS
ARS_consensus_sequence
CDS
LTR_retrotransposon
ORF
W_region
X_element
X_element_combinatorial_repeat
X_region
Y_prime_element
Y_region
Z1_region
...
etc etc)

That every value of column 4 that belongs to them, is stored in them, like classifying them...

And what I'm getting with the code is

{'ARS': 'YAL069W', 'ARS_consensus_sequence': '', 'CDS': 'YAL068W-A', 'LTR_retrotransposon': '', 'ORF': 'ARS102', 'W_region': 'TEL01L', 'X_element': '', 'X_element_combinatorial_repeat': '', 'X_region': '', 'Y_prime_element': 'YAL068C', 'Y_region': '', 'Z1_region': 'YAL067W-A', 'Z2_region': '', 'blocked_reading_frame': 'ARS103', 'centromere': 'YAL067C', 'centromere_DNA_Element_I': '', 'centromere_DNA_Element_II': 'YAL066W', 'centromere_DNA_Element_III': '', 'external_transcribed_spacer_region': 'YAL065C', 'five_prime_UTR_intron': '', 'gene_group': 'YAL064W-B', 'intein_encoding_region': '', 'internal_transcribed_spacer_region': 'YAL064C-A', 'intron': '', 'long_terminal_repeat': 'YAL064W', 'mating_type_region': '', 'matrix_attachment_site': 'YALWdelta1', 'ncRNA_gene': 'YAL063C-A', 'non_transcribed_region': '', 'noncoding_exon': 'YAL063C', 'not in systematic sequence of S288C': '', 'not physically mapped': 'ARS104', 'origin_of_replication': '', 'plus_1_translational_frameshift': 'YAL062W', 'pseudogene': '', 'rRNA_gene': 'YAL061W', 'silent_mating_type_cassette_array': '', 'snRNA_gene': 'YAL060W', 'snoRNA_gene': '', 'tRNA_gene': 'YAL059W', 'telomerase_RNA_gene': '', 'telomere': 'YAL059C-A', 'telomeric_repeat': '', 'transposable_element_gene': 'YAL058W'}

In that output, what it is printing are the 'unique_features' that are already set, but with the Feature Names that do not correspond to it, it is not even printing them all.

EG. FILE:

S000036595  noncoding_exon                  snR18       1   142367  142468  W       2011-02-03  2000-05-19|2007-05-08   
S000000002  ORF Verified    YAL002W VPS8    CORVET complex membrane-binding subunit VPS8|VPL8|VPT8|FUN15    chromosome 1    L000003013  1   143707  147531  W       2011-02-03  2004-01-14|1996-07-31   Membrane-binding component of the CORVET complex; involved in endosomal vesicle tethering and fusion in the endosome to vacuole protein targeting pathway; interacts with Vps21p; contains RING finger motif
S000031737  CDS                 YAL002W     1   143707  147531  W       2011-02-03  2004-01-14|1996-07-31   
S000121255  ARS     ARS108      ARSI-147    chromosome 1        1   147398  147717          2014-11-18  2014-11-18|2007-03-07   Autonomously Replicating Sequence
S000000001  ORF Verified    YAL001C TFC3    transcription factor TFIIIC subunit TFC3|tau 138|TSV115|FUN24   chromosome 1    L000000641|L000002287   1   151166  147594  C   -1  2011-02-03  1996-07-31  Subunit of RNA polymerase III transcription initiation factor complex; part of the TauB domain of TFIIIC that binds DNA at the BoxB promoter sites of tRNA and similar genes; cooperates with Tfc6p in DNA binding; largest of six subunits of the RNA polymerase III transcription initiation factor complex (TFIIIC)
S000030735  CDS                 YAL001C     1   151006  147594  C       2011-02-03  1996-07-31  
S000030734  CDS                 YAL001C     1   151166  151097  C       2011-02-03  1996-07-31  
S000030736  intron                  YAL001C     1   151096  151007  C       2011-02-03  1996-07-31

ANSWER

Answered 2021-Apr-29 at 16:59

Your code is somewhat inefficient in the sense that it repeatedly splits the all the lines up. In the code below, this is only done once when they are first read in from the file. In addition, after reading they're transposed into columns of row since most of the processing is done with respect to what in each column.

from pprint import pprint, pp

NUMCOLS = 4  # Number columns of interest.
filepath = 'SGD_features.tab'

# Retrieve only number of columns needed from each row of data.
with open(filepath) as file:
    rows = [row.split('\t', NUMCOLS)[:NUMCOLS] for row in file.read().splitlines()]

cols = list(zip(*rows))  # Transpose rows and columns for further processing.
unique_features = sorted(set(cols[1]))

print('Quantities of each unique feature')
qty_features = cols[1]
for feature in unique_features:
    print(f'  {qty_features.count(feature)} - {feature}')

feature_dict = {key: [] for key in unique_features}  # Initialize to empty lists.
for col1, col3 in zip(cols[1], cols[3]):
    if col3:
        feature_dict[col1].append(col3)

print()
print('Feature dictionary')
pp(feature_dict, indent=1)

Output from processing the first 15 lines of that SGD_features.tab file you provided a link to in a comment under your question (not the sample data shown in it):

Quantities of each unique feature
  2 - ARS
  4 - CDS
  5 - ORF
  1 - X_element
  1 - X_element_combinatorial_repeat
  1 - telomere
  1 - telomeric_repeat

Feature dictionary
{'ARS': ['ARS102', 'ARS103'],
 'CDS': [],
 'ORF': ['YAL069W', 'YAL068W-A', 'YAL068C', 'YAL067W-A', 'YAL067C'],
 'X_element': [],
 'X_element_combinatorial_repeat': [],
 'telomere': ['TEL01L'],
 'telomeric_repeat': []}

Source https://stackoverflow.com/questions/67309853

QUESTION

How to get unique values/elements of a column?

Asked 2021-Apr-27 at 15:49

I am trying to get the unique values of a column from a tab. The values are repeated and the file has 1,000+ lines, I just want to have the names of the values, not all, and the ones that are repeated. I'm working on my code, but when I do "RUN" it generates the separate and random letters of the values (see example in 'Output' below). I hope someone can help me find my mistake. Please and thank you very much!

Code:

# Open file
file = open('SGD_features.tab')

# Demonstrate the use of a data structure to represent all unique feature types (column 2).

# Iterate for just one iteration
for line in file:

      # Get rid of new lines at the end.
      line = line.strip()

      # File is tab-delimited.
      elems = line.split("\t")
      features = elems[1]
      unique_list = str(set(features))

      print(unique_list)

Output:

{'O', 'F', 'R'}
{'S', 'C', 'D'}
{'O', 'F', 'R'}
{'S', 'C', 'D'}
{'S', 'A', 'R'}
{'e', 'l', 'o', 'm', 'r', 't'}
{'e', 'l', 'i', 'p', 'a', 'o', 'm', 'r', '_', 't', 'c'}
{'X', 'e', 'l', 'm', '_', 't', 'n'}
{'X', 'e', 'b', 'l', 'i', 'p', 'a', 'o', 'm', 'r', '_', 't', 'c', 'n'}
{'O', 'F', 'R'}
{'S', 'C', 'D'}
{'O', 'F', 'R'}
{'S', 'C', 'D'}

And so on...

DESIRED OUTPUT:

ORF
CDS
ARS
telomere
telomeric_repeat
X_element
X_element_combinatorial_repeat

EX. FILE

S000036595  noncoding_exon                  snR18       1   142367  142468  W       2011-02-03  2000-05-19|2007-05-08   
S000000002  ORF Verified    YAL002W VPS8    CORVET complex membrane-binding subunit VPS8|VPL8|VPT8|FUN15    chromosome 1    L000003013  1   143707  147531  W       2011-02-03  2004-01-14|1996-07-31   Membrane-binding component of the CORVET complex; involved in endosomal vesicle tethering and fusion in the endosome to vacuole protein targeting pathway; interacts with Vps21p; contains RING finger motif
S000031737  CDS                 YAL002W     1   143707  147531  W       2011-02-03  2004-01-14|1996-07-31   
S000121255  ARS     ARS108      ARSI-147    chromosome 1        1   147398  147717          2014-11-18  2014-11-18|2007-03-07   Autonomously Replicating Sequence
S000000001  ORF Verified    YAL001C TFC3    transcription factor TFIIIC subunit TFC3|tau 138|TSV115|FUN24   chromosome 1    L000000641|L000002287   1   151166  147594  C   -1  2011-02-03  1996-07-31  Subunit of RNA polymerase III transcription initiation factor complex; part of the TauB domain of TFIIIC that binds DNA at the BoxB promoter sites of tRNA and similar genes; cooperates with Tfc6p in DNA binding; largest of six subunits of the RNA polymerase III transcription initiation factor complex (TFIIIC)
S000030735  CDS                 YAL001C     1   151006  147594  C       2011-02-03  1996-07-31  
S000030734  CDS                 YAL001C     1   151166  151097  C       2011-02-03  1996-07-31  
S000030736  intron                  YAL001C     1   151096  151007  C       2011-02-03  1996-07-31

ANSWER

Answered 2021-Apr-27 at 14:11

features is just one string in one line of the file, not all the strings in that column.

Add each word to the unique_list set in the loop, and print the set at the end.

unique_list = set()
for line in file:
    line = line.strip()
    unique_list.add(line.split('\t')[1])

print(unique_list)

Source https://stackoverflow.com/questions/67275587

QUESTION

Why am I getting uneven vertical padding in a Motif Widget List?

Asked 2021-Apr-11 at 14:00

I am using a Motif Widget Scrolledlist. The list is created as follows:

/* COMMAND GROUP LIST */
ac = 0;
XtSetArg(al[ac], XmNselectionPolicy, XmSINGLE_SELECT); ac++;
XtSetArg(al[ac], XmNtopAttachment, XmATTACH_WIDGET); ac++;
XtSetArg(al[ac], XmNtopWidget, printer_menu_button); ac++;
XtSetArg(al[ac], XmNleftAttachment, XmATTACH_FORM); ac++;
XtSetArg(al[ac], XmNrightAttachment, XmATTACH_FORM); ac++;
XtSetArg(al[ac], XmNbottomAttachment, XmATTACH_POSITION); ac++;
XtSetArg(al[ac], XmNbottomPosition, 50); ac++;
command_group_list = XmCreateScrolledList(form, "command_group_list", al, ac);
XtManageChild(command_group_list);

the items are added by a callback function when the printer is selected. from the routine adding the items the only relevant Motif-related commands are:

XmListDeleteAllItems(command_group_list);
...
str = XmStringCreateLocalized(command_group_line);
XmListAddItem(command_group_list, str, 0); 
XmStringFree(str);

However, when I display the list I get a weird bottom padding, seems like the height of each individual item of the list is larger than the height of the text. This can be seen in this image:

While in the documentation (for example O'Reilly Volume Six A) the list's items appear to have a "normal" height. I do not know what there could be missing. I have reviewed if the sample code in 6A apply more resources to the list but I can not find anything.

For example, this list screenshot, extracted from 6A shows how the height is what you would normally expect in a list:

I am using FreeBSD and OpenMotif 2.3.8_1.

Could it be a font issue?

UPDATE: this is the whole routine that adds the items, as stated above, the only Motif/X11 code are the Xm functions deleting all items and adding individual items in a for loop.

This is the routine which populates the items (note that mostly is C code non-related to the actual Motif issue):

/* THIS FUNCTION READS COMMAND GROUPS USED BY THIS PRINTER */
void read_command_group(char *printer_name) {

    /* BUILD FILE PATH */
    char filepath[256];
    strcpy(filepath, "/etc/xcmdprinter/");
    strcat(filepath, printer_name);

    /* OPEN AND READ FILE */
    char line[256];
    FILE *fp = fopen(filepath, "r");
    while(fgets(line, sizeof(line), fp)) {
        if(line[0]=='G') {
            XmString str;
            char command_group_line[256];
            int i=2;
            while(line[i]!='\0') {
                command_group_line[i-2] = line[i];
                i++;
            }
            command_group_line[i-2] = '\0';
            str = XmStringCreateLocalized(command_group_line);
            XmListAddItem(command_group_list, str, 0); 
            XmStringFree(str);
        }
    }
    fclose(fp);

}

/* CALLBACK FUNCTION FOR PRINTER SELECTION */
void select_printer(Widget w, XtPointer client_data, XtPointer call_data) {

    XmListDeleteAllItems(command_group_list);
    read_command_group((char *)client_data);
}

ANSWER

Answered 2021-Apr-11 at 14:00

Each item contains a newline character; remove it.

I am also wondering why the focus is displayed with such a strong dotted line.

That is set by the list widget's resource XmNhighlightThickness, whose default value is 2.

Source https://stackoverflow.com/questions/67042738

QUESTION

Creating an option menu in Motif

Asked 2021-Apr-06 at 17:53

I am trying to create an option menu using Motif toolkit.

If I try this, it works:

#include <stdlib.h>
#include <stdio.h>
#include <dirent.h>
#include <Xm/Xm.h>
#include <Xm/Form.h>
#include <Xm/Label.h>
#include <Xm/PushB.h>
#include <Xm/RowColumn.h>

Widget make_menu_item(char *item_name, Widget menu);

/* XT/XM RELATED VARIABLES */
XtAppContext context;
XmStringCharSet char_set = XmSTRING_DEFAULT_CHARSET;

/* WIDGETS */
Widget toplevel; 
Widget form;
Widget pulldown_menu;
Widget option_menu;
Widget option_item[100];
int option_items = 0;

int main(int argc, char *argv[]) {

    Arg al[10];
    int ac;

    /* CREATE TOP SHELL WIDGET */
    toplevel = XtAppInitialize(&context, "", NULL, 0, &argc, argv, NULL, NULL, 0);

    /* RESIZE TOP LEVEL*/
    ac = 0;
    XtSetArg(al[ac], XmNheight, 900); ac++;
    XtSetArg(al[ac], XmNwidth, 600); ac++;
    XtSetValues(toplevel, al, ac);

    /* PULLDOWN MENU */
    ac = 0;
    pulldown_menu = XmCreatePulldownMenu(toplevel, "pulldown_menu", al, ac);

    ac = 0;
    XtSetArg(al[ac], XmNsubMenuId, pulldown_menu); ac++;
    XtSetArg(al[ac], XmNlabelString, XmStringCreate("Pulldown Menu", char_set)); ac++;
    option_menu = XmCreateOptionMenu(toplevel, "option_menu", al, ac);
    XtManageChild(option_menu);
    make_menu_item("FOO", pulldown_menu);
    make_menu_item("BAR", pulldown_menu);

    /* REALIZE TOPLEVEL */
    XtRealizeWidget(toplevel);
    XtAppMainLoop(context);

    return 0;

}

Widget make_menu_item(char *item_name,  Widget menu) {

    int ac;
    Arg al[10];
    Widget item;

    ac = 0;
    XtSetArg(al[ac], XmNlabelString, XmStringCreateLtoR(item_name, char_set)); ac++;
    item = XmCreatePushButton(menu, item_name, al, ac);
    XtManageChild(item);
    /*XtAddCallback(item, XmNactivateCallback, menuCB, client_data);*/
    XtSetSensitive(item, True);
    return(item);

}

However, when I try to use form as parent for PulldownMenu and OptionMenu it does not work. How can I attach an option menu to a form? Why the option menu is not displayed in this case?

#include <stdlib.h>
#include <stdio.h>
#include <dirent.h>
#include <Xm/Xm.h>
#include <Xm/Form.h>
#include <Xm/Label.h>
#include <Xm/PushB.h>
#include <Xm/RowColumn.h>

Widget make_menu_item(char *item_name, Widget menu);

/* XT/XM RELATED VARIABLES */
XtAppContext context;
XmStringCharSet char_set = XmSTRING_DEFAULT_CHARSET;

/* WIDGETS */
Widget toplevel; 
Widget form;
Widget pulldown_menu;
Widget option_menu;
Widget option_item[100];
int option_items = 0;

int main(int argc, char *argv[]) {

    Arg al[10];
    int ac;

    /* CREATE TOP SHELL WIDGET */
    toplevel = XtAppInitialize(&context, "", NULL, 0, &argc, argv, NULL, NULL, 0);

    /* RESIZE TOP LEVEL*/
    ac = 0;
    XtSetArg(al[ac], XmNheight, 900); ac++;
    XtSetArg(al[ac], XmNwidth, 600); ac++;
    XtSetValues(toplevel, al, ac);

    /* CREATE FORM MANAGER WIDGET */
    form = XmCreateForm(toplevel, "form", al, ac);

    /* PULLDOWN MENU */
    ac = 0;
    pulldown_menu = XmCreatePulldownMenu(form, "pulldown_menu", al, ac);

    ac = 0;
    XtSetArg(al[ac], XmNsubMenuId, pulldown_menu); ac++;
    XtSetArg(al[ac], XmNlabelString, XmStringCreate("Pulldown Menu", char_set)); ac++;
    option_menu = XmCreateOptionMenu(form, "option_menu", al, ac);
    XtManageChild(option_menu);
    make_menu_item("FOO", pulldown_menu);
    make_menu_item("BAR", pulldown_menu);

    /* REALIZE TOPLEVEL */
    XtRealizeWidget(toplevel);
    XtAppMainLoop(context);

    return 0;

}

Widget make_menu_item(char *item_name,  Widget menu) {

    int ac;
    Arg al[10];
    Widget item;

    ac = 0;
    XtSetArg(al[ac], XmNlabelString, XmStringCreateLtoR(item_name, char_set)); ac++;
    item = XmCreatePushButton(menu, item_name, al, ac);
    XtManageChild(item);
    /*XtAddCallback(item, XmNactivateCallback, menuCB, client_data);*/
    XtSetSensitive(item, True);
    return(item);

}

ANSWER

Answered 2021-Apr-06 at 17:53

Add after the line:

XtManageChild(option_menu);

Code to manage the form:

XtManageChild(form);

This will show the option menu.

Source https://stackoverflow.com/questions/66966471

QUESTION

Generating strings of length l with hamming distance d

Asked 2021-Mar-27 at 16:02

I’m working on a variation of the Motif Search Problem and have hit a block on the logic of one of the subparts.

The problem is:

You have the alphabet — ['A', 'C', 'G', 'T']

Now, you are given an array of strings made of these alphabets with length L and are given a hamming distance D.

For example, if we take L=3, d=2 and are given the array ["ACT","TGC","GTA"].

For each string in the array, we must generate strings of the same length (3 in this case) using the alphabet which have a hamming distance of d. The hamming distance d means that the final string will only have d edits (two if d = 2) as compared to the original string.

So if we take the example of ACT from the array, we must generate GTT, AAG, CGT and so on. And I want to store these generated strings in a list.

A recursive function that breaks down the string seems like the most efficient way to do it but I’m having trouble implementing it. Any ideas for the logic explained with code/pseudocode? I need to be able to extend this problem to L = 15 and d = 5.

Example of Hamming distance d = 1.

ANSWER

Answered 2021-Mar-09 at 01:02

This can get you started. It doesn't handle creating strings of different length than the source. Perhaps you could add that.

JavaScript code:

function f(alphabet, str, prefix, i, d){
  if (d == 0)
    return [prefix + str.substr(i)];
    
  let words = [];
  
  for (let j=0; j<alphabet.length; j++){
    if (alphabet[j] != str[i]) 
      words = words.concat(
        f(alphabet, str, prefix + alphabet[j], i+1, d-1)
      );
  }

  if (str.length - i > d)
    words = words.concat(
      f(alphabet, str, prefix + str[i], i+1, d)
    )
  
  return words;
}

const alphabet = ['A', 'C', 'G', 'T'];

const strs = ["ACT", "TGC", "GTA"];

for (let str of strs){
  console.log(str);
  console.log(JSON.stringify(f(alphabet, str, '', 0, 2)));
  console.log('');
}

Source https://stackoverflow.com/questions/66534678

QUESTION

TFBS search with TFBSTools and a for loop

Asked 2021-Mar-26 at 20:57

I am currently looking for TFBS motifs in DNA. The original code I wrote to look for 10 different transcription factor motifs worked beautifully. But now I want to search for more than 100 motifs. Therefore I want to use loops so that I dont have to type in all the motif names manually (and can easily change my list if my interests change). But when I do this my code no longer works. I can print the result of the loops and it looks like the list contains all the correct information, but when I then use this list to compare with my DNA the list seems to only remember the last item of the list.

Here is my original code that works:

initializeJASPARDB("jaspar.sqlite", version="2014")
MA0018.2 <- getMatrixByID(db, ID="MA0018.2")
MA0024.1 <- getMatrixByID(db, ID="MA0024.1")
MA0062.1 <- getMatrixByID(db, ID="MA0062.1")
MA0099.2 <- getMatrixByID(db, ID="MA0099.2")
MA0112.1 <- getMatrixByID(db, ID="MA0112.1")
MA0153.1 <- getMatrixByID(db, ID="MA0153.1")
MA0156.1 <- getMatrixByID(db, ID="MA0156.1")
MA0157.1 <- getMatrixByID(db, ID="MA0157.1")
MA0158.1 <- getMatrixByID(db, ID="MA0158.1")
MA0259.1 <- getMatrixByID(db, ID="MA0259.1")

pwm1 <- toPWM(MA0018.2)
pwm2 <- toPWM(MA0024.1)
pwm3 <- toPWM(MA0062.1)
pwm4 <- toPWM(MA0099.2)
pwm5 <- toPWM(MA0112.1)
pwm6 <- toPWM(MA0153.1)
pwm7 <- toPWM(MA0156.1)
pwm8 <- toPWM(MA0157.1)
pwm9 <- toPWM(MA0158.1)
pwm10 <- toPWM(MA0259.1)

pwmList <- PWMatrixList(pwm1=pwm1, pwm2=pwm2, pwm3=pwm3, pwm4=pwm4, pwm5=pwm5, pwm6=pwm6, pwm7=pwm7, pwm8=pwm8, pwm9=pwm9, pwm10=pwm10)

seq3 <- readDNAStringSet(file = "sequences/HBV/HBV_genotypeEplusFplusGplusHplusRF.fasta")

sitesetList <- searchSeq(pwmList, seq3, min.score="90%")

as(sitesetList, "data.frame")
as(sitesetList, "DataFrame")
as(sitesetList, "GRanges")
#writeGFF3(sitesetList)
Viruses_TFBS <- writeGFF2(sitesetList)

write.csv(Viruses_TFBS, file = "analysis_HBV/HBV_combmanually_10TFBS.csv")

head(Viruses_TFBS, 5)

Here is my new code with the loop:

TFBS_motifs <- read.csv("TFBS_motifs_test.csv")
seqHSV <- readDNAStringSet(file = "sequences/HSV1.fasta")

# for loop objects
TFBS_matrices <- list()
pwms <- list()
TFBS_ID <- TFBS_motifs$ID

for (i in 1:nrow(TFBS_motifs)) {
  
 pwms[[i]] <- toPWM(TFBS_matrices[[i]] <- getMatrixByID(db, ID = TFBS_ID[[i]]))
  
}
 #print(pwms)

pwmList <- PWMatrixList(pwms[[i]])

sitesetList <- searchSeq(pwmList, seqHSV, min.score="90%")


as(sitesetList, "data.frame")
as(sitesetList, "DataFrame")
as(sitesetList, "GRanges")
#writeGFF3(sitesetList)
HSV_TFBS <- writeGFF2(sitesetList)

write.csv(HSV_TFBS, file = "analysis_HBV/HSV_test.csv")

Thank you all so much for any suggestions...

ANSWER

Answered 2021-Mar-26 at 20:57

You don't really need to run this in a loop; most of these commands can deal with lists. Try something like this:

library(TFBSTools)
library(JASPAR2018) # or use 2014 version if you prefer
library(Biostrings)
db <- file.path(system.file("extdata", package="JASPAR2018"), "JASPAR2018.sqlite")

# provide your motifs here or read in from file
mymotifs <- c("MA0018.2", "MA0024.1", "MA0062.1", "MA0099.2") 
PFMatrixList <- getMatrixByID(db, ID=mymotifs)

# provide your genome fasta file here
HSV1 <- readDNAStringSet("ftp://ftp.ebi.ac.uk/pub/databases/ena/wgs/public/fkj/FKJZ01.fasta.gz") 
sitesetList <- searchSeq(toPWM(PFMatrixList), HSV1, min.score="90%")

# generate GRangesList (and unlist if you prefer a single GRanges object)
unlist(as(sitesetList, "GRangesList"))

Source https://stackoverflow.com/questions/66821692

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install motif

Download the latest JAR via Maven:.

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at:

Reuse Trending Solutions

14 best Python Telegram Bot

21 best C# Game Development in 2023

Image Resizing using OpenCV in Python

How to Validate an Email Address in JavaScript

Age Calculator using JavaScript

28 best Python Face Recognition in 2023

Display Stopwatch in ReactJs

Google Maps Integration with Location

Disease Predictor

Resolving Gender Bias in AI

Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from
over 650 million Knowledge Items

Find more libraries

Reuse Solution Kits and Libraries Curated by Popular Use Cases

Save this library and start creating your kit

Install

Maven
Gradle

Clone

HTTPS

https://github.com/johnlcox/motif.git

CLI

gh repo clone johnlcox/motif

SSH

git@github.com:johnlcox/motif.git

Download

Share this Page

See Similar Libraries in

Programming Style

Functional Programming

Reuse Java Kits

17 best Java Video Player

Implementing 2FA

7 best Java Recommender System libr

22 best Java Blockchain

11 best Java Ethereum

See all related Kits

Consider Popular Functional Programming Libraries

by ramda

mostly-adequate-guide

by MostlyAdequate

by scala

by thoughtbot

by fantasyland

See all Functional Programming Libraries

Try Top Libraries by johnlcox

by johnlcox Java

by johnlcox Java

by johnlcox Java

sandbox-runtime

by johnlcox Java

jackson-dataformat-toml

by johnlcox Java

See all Libraries by this author

Compare Functional Programming Libraries with Highest Support

by scala

eclipse-collections

by eclipse

by gcanti

by vavr-io

by ramda

See all Functional Programming Libraries

Compare Functional Programming Libraries with Highest Quality

by mpartel

by sigpwned

by hraberg

by sculptor

by JavaZ

See all Functional Programming Libraries

Compare Functional Programming Libraries with Highest Security

by mpartel

by ktoso

by sigpwned

by MateVM

by hraberg

See all Functional Programming Libraries

Compare Functional Programming Libraries with Permissive License

by ktoso

CompactCollections

by gratianlup

by jawher

functional-utils

by solita

by sculptor

See all Functional Programming Libraries

Compare Functional Programming Libraries with Highest Reuse

by GlenKPeterson

by SegFaultAX

by johnlcox

by mcdiae

by vickumar1981

See all Functional Programming Libraries

Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from
over 650 million Knowledge Items

Find more libraries

Reuse Solution Kits and Libraries Curated by Popular Use Cases

Save this library and start creating your kit

Open Weaver – Develop Applications Faster with Open Source

kandi

Develop Custom Functions

Develop Projects with Kits

Explore Popular Libraries

Product Tour

Community and Support

Self Paced Certifications

Hackathons and Events

FutureSkills Prime

Company

Follow

Terms
Privacy policy
© 2023 Open Weaver Inc.

© 2023 Open Weaver Inc.