AATT | Automated Accessibility Testing Tool | User Interface library

via a program I have received the following pattern count.

Counter({'CCCC': 22115, 'TTTT': 22043, 'AAAA': 22037, 'GGGG': 21930, 'AAAC': 154, 'TTAT': 152, 'CCCA': 152, 'CCTC': 152, 'GGGC': 151, 'TTTG': 150, 'GTGG': 149, 'GCCC': 148, 'CCGC': 145, 'CGGG': 145, 'TGGG': 144, 'AGAA': 144, 'TTGT': 144, 'GAAA': 142, 'CCCG': 142, 'CCCT': 142, 'TCCC': 141, 'CAAA': 139, 'ATTT': 137, 'CGCC': 134, 'GGTG': 133, 'GAGG': 133, 'TTTA': 132, 'CTTT': 131, 'TCTT': 131, 'ACCC': 130, 'AGGG': 130, 'GGAG': 129, 'AACA': 129, 'TAAA': 129, 'TATT': 128, 'TTTC': 128, 'AAGA': 127, 'GGGA': 126, 'ACAA': 126, 'TTCT': 125, 'CTCC': 124, 'GCGG': 124, 'ATAA': 123, 'GGCG': 120, 'CACC': 119, 'AAAT': 118, 'AATA': 117, 'AAAG': 114, 'GTTT': 114, 'TGTT': 112, 'GGGT': 112, 'CCAC': 110, 'CGCG': 45, 'AACC': 43, 'TTAA': 41, 'CTCT': 41, 'GGCC': 41, 'ACTC': 40, 'CTTC': 40, 'GCCG': 39, 'ATTA': 39, 'ACCT': 39, 'TGCG': 39, 'ATAT': 39, 'TCTC': 38, 'ACGG': 38, 'TATA': 37, 'ATCA': 37, 'CGGC': 37, 'CGAG': 36, 'AGAG': 36, 'GACA': 35, 'GTTG': 35, 'TGAG': 35, 'TGGT': 35, 'CCAA': 35, 'TTGG': 34, 'GTGT': 34, 'GCGC': 34, 'CACA': 34, 'GTAA': 34, 'GTAG': 34, 'TCCA': 34, 'TCCT': 34, 'AAGG': 34, 'GAGA': 34, 'GCTT': 34, 'GTGC': 33, 'CTAT': 33, 'TTGC': 33, 'CGGA': 33, 'AGGA': 32, 'GACG': 32, 'AATT': 32, 'CAAC': 32, 'CTGC': 32, 'CTAC': 32, 'ACGA': 32, 'CGAC': 32, 'CCGG': 32, 'TCTG': 32, 'GGAA': 32, 'GGAT': 32, 'TGCT': 32, 'TTAG': 32, 'GCTG': 32, 'GAGT': 31, 'AGGC': 31, 'TTCC': 31, 'ATGA': 31, 'TTCA': 31, 'CCAT': 31, 'AAGT': 31, 'GAGC': 31, 'GTAT': 31, 'CGAA': 31, 'TCAT': 31, 'ATTC': 31, 'TGTG': 30, 'AGTT': 30, 'ATCC': 30, 'AGCA': 30, 'GTCT': 30, 'TGTC': 30, 'TCAC': 30, 'CACT': 30, 'ACTA': 30, 'TAAT': 30, 'CCGT': 30, 'CCTA': 29, 'TCGG': 29, 'GGTA': 29, 'TATG': 29, 'AACG': 29, 'CACG': 29, 'GATT': 29, 'ATCT': 29, 'TGGC': 29, 'AGCC': 29, 'TATC': 29, 'GCTC': 29, 'GGCT': 29, 'TCTA': 29, 'AACT': 28, 'CCTT': 28, 'CTTA': 28, 'TGTA': 28, 'TAGT': 28, 'AGTG': 28, 'CCGA': 27, 'AATG': 27, 'CCTG': 27, 'CTGT': 27, 'AGTC': 27, 'GTCC': 27, 'GGTT': 27, 'ACAC': 26, 'TACC': 26, 'CATC': 26, 'CATA': 26, 'GTGA': 26, 'TGAA': 26, 'GGTC': 26, 'CTTG': 26, 'GCAC': 26, 'GGCA': 26, 'CGTC': 26, 'CTGG': 26, 'TAAG': 26, 'TCGT': 26, 'TGAT': 25, 'CAGA': 25, 'GAAC': 25, 'ACCA': 25, 'TTAC': 25, 'CATT': 25, 'AGAT': 25, 'CGGT': 25, 'ATTG': 25, 'TTGA': 25, 'GATA': 24, 'GGAC': 24, 'AAGC': 24, 'GTCA': 24, 'CAAT': 24, 'GCAG': 24, 'ACAT': 24, 'TGCC': 24, 'ATAG': 24, 'CGTG': 24, 'CGCA': 24, 'TAGG': 23, 'ACCG': 23, 'TTCG': 23, 'AGCG': 23, 'GTTC': 23, 'ACTT': 23, 'CGTT': 23, 'AGAC': 23, 'GCAT': 22, 'TCCG': 22, 'TAAC': 22, 'ACGC': 22, 'CAGC': 22, 'GACC': 22, 'CATG': 22, 'TCGA': 22, 'TAGA': 22, 'GCAA': 22, 'CTCG': 22, 'TACT': 22, 'AATC': 21, 'CGCT': 21, 'GAAT': 21, 'GCGT': 21, 'AGTA': 21, 'GCCA': 21, 'ATGG': 21, 'TCAA': 21, 'CTCA': 21, 'TGGA': 20, 'GAAG': 20, 'GATC': 20, 'TGCA': 20, 'GCCT': 19, 'GTCG': 19, 'CAAG': 19, 'TCGC': 19, 'CTGA': 19, 'GATG': 19, 'CTAA': 19, 'GCGA': 19, 'ATAC': 18, 'GTTA': 18, 'GCTA': 18, 'AGGT': 18, 'CCAG': 18, 'ACAG': 18, 'CTAG': 17, 'CGTA': 17, 'ACGT': 17, 'TACA': 17, 'AGCT': 16, 'CAGG': 16, 'ATGT': 16, 'ATCG': 16, 'ATGC': 15, 'TGAC': 14, 'TAGC': 14, 'ACTG': 14, 'TCAG': 14, 'CGAT': 14, 'TACG': 13, 'CAGT': 11, 'GTAC': 10, 'GACT': 9})

I want to convert it now as a list, so that in the first column "AAAA" there are all corresponding values and so also for all combinations. Does anyone have an idea how to program this well?

This is how I read the data into R:

daten <- read.table("/PATTERN.txt", header = FALSE, sep = "\t");

So far I've tried direct reading, but somehow it doesn't really work. It should look like this:

AAAA CCCC

1 22128 22127

Thank you very much!

I am trying to automate a process of appending data from a fillable word document to Excel sheet.
Here is my code:

I'm working on a simple bioinformatics problem. I have a working solution, but it is absurdly inefficient. How can I increase my efficiency?

Problem:

Find patterns of length k in the string g, given that the k-mer can have up to d mismatches.

And these strings and patterns are all genomic--so our set of possible characters is {A, T, C, G}.

I'll call the function FrequentWordsMismatch(g, k, d).

So, here are a few helpful examples:

FrequentWordsMismatch('AAAAAAAAAA', 2, 1) → ['AA', 'CA', 'GA', 'TA', 'AC', 'AG', 'AT']

Here's a much longer example, if you implement this and want to test:

FrequentWordsMisMatch('CACAGTAGGCGCCGGCACACACAGCCCCGGGCCCCGGGCCGCCCCGGGCCGGCGGCCGCCGGCGCCGGCACACCGGCACAGCCGTACCGGCACAGTAGTACCGGCCGGCCGGCACACCGGCACACCGGGTACACACCGGGGCGCACACACAGGCGGGCGCCGGGCCCCGGGCCGTACCGGGCCGCCGGCGGCCCACAGGCGCCGGCACAGTACCGGCACACACAGTAGCCCACACACAGGCGGGCGGTAGCCGGCGCACACACACACAGTAGGCGCACAGCCGCCCACACACACCGGCCGGCCGGCACAGGCGGGCGGGCGCACACACACCGGCACAGTAGTAGGCGGCCGGCGCACAGCC', 10, 2) → ['GCACACAGAC', 'GCGCACACAC']

With my naive solution, that second example could easily take ~60 seconds, though the first one is pretty quick.

Naive solution:

My idea was to, for every k-length segment in g, find every possible "neighbor" (e.g. other k-length segments with up to d mismatches) and add those neighbors as keys to a dictionary. I then count how many times each one of those neighbor kmers show up in the string g, and record those in the dictionary.

Obviously that's a kinda shitty way to do that, since the amount of neighbors scales like crazy as k and d increase, and having to scan through the strings with each of those neighbors makes this implementation terribly slow. But alas, that's why I'm asking for help.

I'll put my code below. There're definitely a lot of novice mistakes to unpack, so thanks for your time and attention.

I have JSON object oAtt declared as

var oAtt = MessageStore.message().attachments();

MessageStore.message() is declared in the code available here: https://github.com/RainLoop/rainloop-webmail/blob/master/dev/Model/Message.js

When I output it to the console oArr came as [object Object],[object Object]. After stringify it came as:

I want to count all values if the condition is equal to 1 in a specific column.

I am running this query:

I have a method that takes in an ArrayList of strings with each element in the list equaling to a variation of:

I am new to the node js world. I am trying to execute this command from command prompt and vscode powershell window.These are the commands I had to execute