Decompose | Kotlin Multiplatform lifecycle-aware business logic | Android library
kandi X-RAY | Decompose Summary
kandi X-RAY | Decompose Summary
Here are some key concepts of the library, more details can be found in the documentation.
Support
Quality
Security
License
Reuse
Top functions reviewed by kandi - BETA
Currently covering the most popular Java, JavaScript and Python libraries. See a Sample of Decompose
Decompose Key Features
Decompose Examples and Code Snippets
Lines of Code : 99License : Non-SPDX (Apache License 2.0)
Copydef _decompose_slice_spec(self, slice_spec):
"""Decompose a global slice_spec into a list of per-variable slice_spec.
`ShardedVariable` only supports first dimension partitioning, thus
`slice_spec` must be for first dimension.
Args: def _decompose_indices(self, indices):
"""Decompose a global 1D indices into a list of per-variable indices."""
if indices.shape.rank != 1:
raise ValueError(
'ShardedVariable: indices must be 1D Tensor for sparse operations. ' def cholesky(lin_op_a, name=None):
"""Get the Cholesky factor associated to lin_op_a.
Args:
lin_op_a: The LinearOperator to decompose.
name: Name to use for this operation.
Returns:
A LinearOperator that represents the lower Chole compute P = A'*A
solve P*x = A'*b
decompose A as A = Q*(R )
(0 )
transform b into b~ = Q'*b
(here R is upper triangular)
solve R * x = b# for x,
(here b# is the firstgetKeys : Collection -> List String
getKeys None = []
getKeys (Cons name _ rest) = name :: getKeys rest
fromFalse : (d : Dec p) -> {auto isFalse : decAsBool d = False} -> Not p
fromFalse (Yes _) {isFalse = Refl} impossible
fromFasquareRoot :: Integral t => t -> t
squareRoot n
| n > 0 = babylon n
| n == 0 = 0
| n < 0 = error "Negative input"
where
babylon a | a > b = babylon b
| otherwise = a
where b = `/System/Library/CoreServices/CoreTypes.bundle/Contents/Resources`
set iconFIle to choose file "Choose an icon file" of type {"com.apple.icns"} ¬
default location POSIX file "/System/Library/CoreServices/CoreTyderiv :: (Double -> Double) -> Double -> Double
type ℝ = Double
deriv :: (ℝ -> ℝ) -> ℝ -> ℝ
grad :: ((ℝ,ℝ) -> ℝ) -> (ℝ,ℝ) -> (ℝ,ℝ)
grad f SELECT
pid,
/*
Decompose the query in parts:
1. groupArray((value, count)): convert the group of rows with the same 'pid' to the array of tuples (value, count)
2. arrayReverseSort: make reverse sclone_deep( T , C ) :- clone_deep( T, [], C, _ ).
% T: source term
% S: symbol table
% C: cloned term
% S1: [possibly] extended symbol table
clone_deep( T , S , C, S1 ) :-
var(T), % term is a variable
map_var(T,Community Discussions
Trending Discussions on Decompose
QUESTION
I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?
...ANSWER
Answered 2022-Mar-26 at 00:31You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):
Change
QUESTION
In order to make a time series app with plot for analysis, I want to use the autoplot function of the forecast package, to provide stl decomposition.
However, it seems like there is no functionality given, to resize the text size of x and y axis. The base plot() arguments have no effect:
...ANSWER
Answered 2022-Mar-18 at 11:28autoplot comes from ggplot2. So you will need to use the ggplot2 functions to adjust items from the autoplot.
E.g. for adjusting the title size:
QUESTION
Hi everyone I need to understand how to decompose an array to assign sub-blocks to a fixed number of processors. The case where the remainder among the number of elements% processes == 0 is simple, I would like to know a performing way to do it in case the remainder is different from 0. Maybe if it is possible to have a code example (in C using MPI) to better understand these wait. Furthermore, I would like to ask you which of:
- blockwise decomposition
- cyclic decomposition
- block cyclic decomposition
it is more efficient (assuming that sending and receiving data has a certain cost), and if there is still something faster for that purpose. Thank you all.
...ANSWER
Answered 2022-Feb-01 at 22:36The simplest solution is to give every process N/P points, rounded down, and the last process the excess. That is also a bad solution: it means that with unbalanced load all processes will be waiting for the last one.
Next best: every process gets (N+P-1)/P points, rounding that fraction up. Now the last process gets a smaller number of points. That's a lot better: now one process will have some idle time.
Best solution I know is to assign each process the range defined as follows:
QUESTION
I have a time series taken from this link, i used these commands to separate the components of the time series:
...ANSWER
Answered 2022-Jan-28 at 11:27You could hack the stats:::plot.decomposed.ts method and add a (expandable) dictionary as well as an add2main component.
QUESTION
I have the following simple dataframe. I would like to find a clean tidyverse solution to decompose each sequence by row into its subsequences. I think it will be very clear what I mean when you see the examples. This is the starting code.
...ANSWER
Answered 2022-Jan-27 at 20:32This is not a clean way to do it, but it works:
QUESTION
In the below data frame I'd like to evaluate the following compound inequality:
df['B'] <= df['E'].shift(1) <= df['A']
ANSWER
Answered 2022-Jan-26 at 20:19A simple way to do that is to use between:
QUESTION
I want to join an element in this case it's "*" between each element of the list but not at the first position and not in the last position
How can I do this ?
Code :
...ANSWER
Answered 2022-Jan-07 at 01:49This way:
QUESTION
Right now my app has one single activity which has full support of WS actions with listeners and creating new instance of webSocket. I would like to decompose this to one activity which will be like a holder for several fragments.
At the beginning I would like to create webSocket in the activity and then work with created webSocket on fragments. I work with okHttp3 websockets. In general I can for example create one single viewModel where I will initialize websocket, but I need to pass also listener during WS creating:
...ANSWER
Answered 2022-Jan-04 at 17:39To use this solution you must be familiar with these fundamentals
- MVVM architecture
- Kotlin flows (reactive programming)
first, create a sealed data class to handle socket events:
QUESTION
From Phases of translation, backslash joining next line happens in Phase 2 and string literal evaluation happens in Phase 3. Then why does the following code does string evaluation before?
...ANSWER
Answered 2021-Dec-25 at 16:29Raw string literals explicitly undo phases 1&2:
If the next character begins a sequence of characters that could be the prefix and initial double quote of a raw string literal, such as R", the next preprocessing token shall be a raw string literal. Between the initial and final double quote characters of the raw string, any transformations performed in phases 1 and 2 (universal-character-names and line splicing) are reverted; this reversion shall apply before any d-char, r-char, or delimiting parenthesis is identified.
QUESTION
I am currently trying to crawl headlines of the news articles from https://7news.com.au/news/coronavirus-sa.
After I found all headlines are under h2 classes, I wrote following code:
...ANSWER
Answered 2021-Dec-20 at 08:56Your selection is just too general, cause it is selecting all
.decompose() to fix the issue.
How to fix?
Select the headlines mor specific:
Community Discussions, Code Snippets contain sources that include Stack Exchange Network
Vulnerabilities
No vulnerabilities reported
Install Decompose
Support
Reuse Trending Solutions
Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items
Find more librariesStay Updated
Subscribe to our newsletter for trending solutions and developer bootcamps
Share this Page
