TTC | TTC : A high-performance Compiler for Tensor Transpositions | Machine Learning library

by HPAC Python Version: Current License: GPL-3.0

X-Ray Key Features Code Snippets Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | TTC Summary

TTC is a Python library typically used in Artificial Intelligence, Machine Learning, Pytorch applications. TTC has no bugs, it has no vulnerabilities, it has build file available, it has a Strong Copyleft License and it has low support. You can download it from GitHub.

TTC: A high-performance Compiler for Tensor Transpositions

Support

Quality

Security

License

Reuse

Support

TTC has a low active ecosystem.

It has 14 star(s) with 0 fork(s). There are 10 watchers for this library.

It had no major release in the last 6 months.

There are 3 open issues and 4 have been closed. On average issues are closed in 0 days. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of TTC is current.

Quality

TTC has 0 bugs and 0 code smells.

Security

TTC has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

TTC code analysis shows 0 unresolved vulnerabilities.

There are 0 security hotspots that need review.

License

TTC is licensed under the GPL-3.0 License. This license is Strong Copyleft.

Strong Copyleft licenses enforce sharing, and you can use them when creating open source projects.

Reuse

TTC releases are not available. You will need to build from source code and install.

Build file is available. You can build the component from source.

Installation instructions, examples and code snippets are available.

It has 5346 lines of code, 132 functions and 14 files.

It has high code complexity. Code complexity directly impacts maintainability of the code.

Top functions reviewed by kandi - BETA

kandi has reviewed TTC and discovered the below as its top functions. This is intended to give you an instant insight into TTC implemented functionality, and help decide if they suit your requirements.

generate transposition
Prints the code .
The main entry point .
Initialize CUDA .
Create the db tables
Create benchmark per - percentile plot .
Get the best preference for a given constraint .
Gets the update string
print loop body
Generate Eigencode .

Get all kandi verified functions for this library.

TTC Key Features

No Key Features are available at this moment for TTC.

TTC Examples and Code Snippets

No Code Snippets are available at this moment for TTC.

Community Discussions

Trending Discussions on TTC

How do I export a dataframe produced by R?

Make Hikari discord bot only listen to one channel

Combine data with same ID

htaccess don't use index.html to send everything else to wordpress

mPDF Japanese font configuration

Ignoring incomplete triplet in protein translation

Swift macOS : view is not loaded and IBOulets are nil in View Controller

How to calculate invoice total amounts of multiple inputs using jquery?

Variables not being reassigned in Loop

Iterating through dictionary lists with another list, and finding associated key of value

QUESTION

How do I export a dataframe produced by R?

Asked 2022-Apr-14 at 16:47

I fail to export a dataframe produced by uco(seqinr) function in rscu computation. What means should I use?. The dataframe is not showing in r environment either, it only remain in the console. Have tried so much copying it to excel, word, notepad in vain. Could someone help?

...

ANSWER

Answered 2022-Apr-14 at 16:47

First of all, store the output of the function in a variable, e.g.:

Source https://stackoverflow.com/questions/71874756

QUESTION

Make Hikari discord bot only listen to one channel

Asked 2022-Apr-14 at 15:58

I just mada a discord bot with hikari that for now listens to a whole server, and if someone types

...

ANSWER

Answered 2022-Apr-14 at 15:58

GuildMessageCreateEvent has the channel_id attribute which contains the ID of the channel that the message was created in. You can use a simple if-statement guard to ensure that the command is only run in your chosen channel.

For example:

Source https://stackoverflow.com/questions/71871565

QUESTION

Combine data with same ID

Asked 2022-Apr-10 at 01:10

I have an assignment where I need to use aggregate functions in the queries. I keep running into a problem where there are multiply entries for the same ID, and I would rather them be combined into one run (added together for the same ID).

...

ANSWER

Answered 2022-Apr-10 at 01:10

You want to sum the TotalPledge values for each intTeamandClubID. For that you would need to create a different group for each intTeamandClubID. In your case, since you are selecting multiple columns, you will create a group for each unique combination of those columns, which is done by a GROUP BY statement.

You already have that in your query, but you are also grouping by TotalPledge, which you don't want. You want to SUM that value, so you should remove it from the GROUP BY:

Source https://stackoverflow.com/questions/71812760

QUESTION

htaccess don't use index.html to send everything else to wordpress

Asked 2022-Apr-07 at 21:14

I had a site completely run in wordpress. Made a new site from scratch and saved it to index.html. I made the htaccess file work for sending all other urls to the wordpress. The only problem is that I want the home page to be url.com/ instead of url.com/index.html in the address bar of the browser.

How do i keep everything working, except this one little thing?

...

ANSWER

Answered 2022-Apr-07 at 21:14

Set the following at the top of the .htaccess file:

Source https://stackoverflow.com/questions/71786233

QUESTION

mPDF Japanese font configuration

Asked 2022-Mar-28 at 10:06

I need to generate a PDF using mPDF and YuGothM.ttc font for a Japanese client. The page I need to export in PDF contains some text which in browser version (HTML) is rendered well, but in the PDF, the same text has some characters using a font and other characters some default font which is not approved by the client. I understand I have to define TTCfontID parameter in every font definition for .ttc files, but I just don't understand the meanings of those definitions and so how to properly configure fonts.

The script is used in a WordPress website using Polylang plugin for translations.

...

ANSWER

Answered 2022-Mar-28 at 10:06

Eventually I've changed the script to use TCPDF and this way has actually worked very nice. I know this answer did not respond to the question I've asked, but it solved my problem.

Source https://stackoverflow.com/questions/71570131

QUESTION

Ignoring incomplete triplet in protein translation

Asked 2022-Mar-26 at 01:02

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

...

ANSWER

Answered 2022-Mar-26 at 00:31

You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):

Change

Source https://stackoverflow.com/questions/71624409

QUESTION

Swift macOS : view is not loaded and IBOulets are nil in View Controller

Asked 2022-Mar-13 at 12:51

I'm writting a simple VAT calculator

I would like change the aspect of TextFields, focused one as white background and the others have grey background.

Event sending for Textfields seems to be when leave focus, so as i want to change color when enter focus, i've subclass NSTextField in FATextfield. Detect which Textfield as focus is OK.

After that, i would like to have a function that changes background according to the actual focused TextField.

I don't understand in my textFieldsLookUpdate function, view is not loaded and all FATextFields are nil ...

Thanx

My FATextField class :

...

ANSWER

Answered 2022-Mar-05 at 18:06

The problem is actually in the previous line:

Source https://stackoverflow.com/questions/71363046

QUESTION

How to calculate invoice total amounts of multiple inputs using jquery?

Asked 2022-Feb-28 at 10:59

I retrieve all items from order_items table using a foreach loop and then I want to modify quantity and prices of each item.

What I want is to calculate instantly the subtotal and total amount of all items using jQuery but I couldn't find a way to make it work.

...

ANSWER

Answered 2022-Feb-28 at 10:59

Here is a delegated version

I use input event since it triggers on paste too

Source https://stackoverflow.com/questions/71293704

QUESTION

Variables not being reassigned in Loop

Asked 2022-Feb-19 at 04:55

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

...

ANSWER

Answered 2022-Feb-19 at 04:55

I did some refactoring. Can you try the following code?

Source https://stackoverflow.com/questions/71181881

QUESTION

Iterating through dictionary lists with another list, and finding associated key of value

Asked 2022-Feb-04 at 22:09

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

...

ANSWER

Answered 2022-Feb-04 at 22:06

At the following line:

Source https://stackoverflow.com/questions/70993124

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install TTC

Clone the repository into a desired directory and change to that location:. git clone https://github.com/HPAC/TTC.git cd TTC. python setup.py install --user.
Clone the repository into a desired directory and change to that location: git clone https://github.com/HPAC/TTC.git cd TTC
Install TTC: python setup.py install --user
Make sure that you export the TTC_ROOT environment variable (add to your .bashrc): export TTC_ROOT=pwd
You might have to add the installed location to your PATH environment variable: export PATH=$PATH:~/.local/bin
Please run ttc --help to get an overview of TTC's parameters.