GAG | Global Attributed Graph Neural Network for Streaming Session | Recommender System library
kandi X-RAY | GAG Summary
kandi X-RAY | GAG Summary
"GAG: Global Attributed Graph Neural Network for Streaming Session-based Recommendation", SIGIR 2020. If you find this repo helpful, please cite this paper.
Support
Quality
Security
License
Reuse
Top functions reviewed by kandi - BETA
- Calculate the entropy of a union
- Calculate the entropy of a model
- Sample a new set of new windows
- Compute the entropy for a new session
- Processes the training data
- Load test data from a pickle file
- Load data from a pickle file
- Perform the forward computation
- Calculate the norm of a graph
- Update the map with the given data
- Add values to the data
- Fix new entropy on new windows
- Generate a random selection based on a union
- Performs a forward computation
- Load test sets
- Load training data from a pickle file
- Randomize a new window
GAG Key Features
GAG Examples and Code Snippets
Community Discussions
Trending Discussions on GAG
QUESTION
I fail to export a dataframe produced by uco(seqinr) function in rscu computation. What means should I use?. The dataframe is not showing in r environment either, it only remain in the console. Have tried so much copying it to excel, word, notepad in vain. Could someone help?
...ANSWER
Answered 2022-Apr-14 at 16:47First of all, store the output of the function in a variable, e.g.:
QUESTION
I am trying to write a function that accepts an array of strings as an argument. I want to return the array of strings sorted first by number of vowels and then alphabetically.
Input: ['dog', 'cat', 'elephant', 'hippo', 'goat'] Output: ['cat', 'dog', 'goat', 'hippo', 'elephant']
...ANSWER
Answered 2022-Apr-02 at 10:41This can be done in a single .sort();
QUESTION
I have the following problem, which I have been able to solve in a very long way and I would like to know if there is any other way to solve it. I have the following string structure:
text = 01 ARA 22 - 02 GAG 23
But due to processing sometimes the spaces are not added properly and it may look like this:
...ANSWER
Answered 2022-Mar-28 at 05:27You can use a regex to capture each of the components in the text, and then replace any missing spaces with a space:
QUESTION
I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?
...ANSWER
Answered 2022-Mar-26 at 00:31You can use .get(), which returns the value of the key if it exists in the dictionary, else it returns the second parameter to .get() (by default, .get() returns None, but we explicitly specify - here per the question's requirements):
Change
QUESTION
It might be a stupid question, but I am trying to learn how to work with Near Protocol in Near academy.
In chapter 6, you have a task to login to NEAR using CLI, register yourself as a meme museum contributor and register your meme.
Link to the Chapter 6: https://near.academy/near101/chapter-6
I have an issue when I try to register the meme. I am getting an error:
Unknown argument: {meme : bingoo, title : telephonememe, data : https://9gag.com/gag/a718nWb, category : 4}
I am not sure why those arguments are percevied as unknown.
Here's the code:
near call museum.testnet add_meme \ '{"meme" : "bingoo", "title" : "telephonememe", "data" : "https://9gag.com/gag/a718nWb", "category" : 4}' --accountId bingoo.testnet --amount 4
...ANSWER
Answered 2022-Mar-24 at 16:28I'm using a windows machine, and I was getting the same error.
I tried a bunch of things and I saw this AWS post on host to use quotes in the aws cli: https://docs.aws.amazon.com/cli/latest/userguide/cli-usage-parameters-quoting-strings.html
I think for windows you can't use the single quotes around the json object, and you can't do the \ for the newline. I would just one long string and \ the " inside the json. like this:
QUESTION
I am trying to display data by Species that has different values depending on group Letter. The best way I have found to display my data is by putting my categorical data on the y-axis and displaying the Total_Observed on the x-axis. Lemon allows me to have different y-axis labels. Unfortunately, the graph sorts by my y-axis labels instead of using my data as is, which is sorted by most abundant species to least abundant. Any suggestions?
Using libraries: dplyr, ggplot2, lemon
My data:
...ANSWER
Answered 2022-Mar-17 at 13:37Answered by Johan Rosa's shared blog (https://juliasilge.com/blog/reorder-within/): The solution is to use the library(tidytext). With the functions reorder_within and scale_x_reordered.
The corrected code:
test %>% mutate(Species=reorder_within(Species,Total_Observed,Letter)) %>% ggplot(aes(Species,Total_Observed))+geom_histogram(stat='identity')+facet_wrap(~Letter,scales='free_y')+coord_flip()+scale_x_reordered()
QUESTION
I am trying to encrypt (openssl aes-256-cbc) a string through Windows command prompt and decrypt the result in PHP.
I have done the encryption through:
...ANSWER
Answered 2022-Feb-20 at 22:17The OpenSSL statement generates a random 8 bytes salt during encryption, which is used together with the password to derive a 32 bytes key and a 16 bytes IV with the OpenSSL function EVP_BytesToKey().
With key and IV the encryption is performed with AES-256 in CBC mode. The result consists of the concatenation of the ASCII encoding of Salted__, followed by the salt and the actual ciphertext, all Base64 encoded.
The decryption in PHP/OpenSSL must be implemented as follows:
- Determination of salt and actual ciphertext.
- Using salt, password and
EVP_BytesToKey()to get key and IV. - Using key and IV to perform decryption with AES-256 in CBC mode.
One possible implementation is:
QUESTION
Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.
...ANSWER
Answered 2022-Feb-19 at 04:55I did some refactoring. Can you try the following code?
QUESTION
Here's some things I need help with.
But first of all, please let me pull up the code first.
ANSWER
Answered 2022-Feb-11 at 00:21Assuming you're trying to print everything prior to 'STOP' sliced into 3 characters each, here's an extension of your main function:
QUESTION
Here's what I'm doing:
...ANSWER
Answered 2022-Feb-10 at 00:00I would first rewrite your
Community Discussions, Code Snippets contain sources that include Stack Exchange Network
Vulnerabilities
No vulnerabilities reported
Install GAG
You can use GAG like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.
Support
Reuse Trending Solutions
Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items
Find more librariesStay Updated
Subscribe to our newsletter for trending solutions and developer bootcamps
Share this Page
