seq3 | Source code for the NAACL 2019 paper | Machine Learning library

Please give your hints - I have spent a lot of time on this code but have not been able to solve it.

I have a code that gives output in a format I want however the results it shows are not 100% correct.

I have two big FASTA files that look like below (information after # are not in the actual file - I put them in this question for better understanding):

f1.fa

I am currently looking for TFBS motifs in DNA. The original code I wrote to look for 10 different transcription factor motifs worked beautifully. But now I want to search for more than 100 motifs. Therefore I want to use loops so that I dont have to type in all the motif names manually (and can easily change my list if my interests change). But when I do this my code no longer works. I can print the result of the loops and it looks like the list contains all the correct information, but when I then use this list to compare with my DNA the list seems to only remember the last item of the list.

Here is my original code that works:

I have a fasta file with millions of DNA sequences - for each DNA sequence, there is an ID as well.

I have stuck with this script it would be great if you could help me with your inputs. My problem is that I think the script is not that efficient - it takes a lot of time to end running.

I have a fasta file with around 9000 sequence lines (example below) and What my script does is:

1. reads the first line (ignores lines start with >) and makes 6mers (6 character blocks)
2. adds these 6mers to a list
3. makes reverse-complement of previous 6mers (list2)
4. saves the line if non of the reverse-complement 6mers are in the line.
5. Then goes to the next line in the file, and check if it contains any of the reverse-complement 6mers (in list2). If it does, it discards it. If it does not, it saves that line, and reads all reverse complement 6-mers of the new one into the list2 - in addition to the reverse-complement 6-mers that were already there.

my file:

I have tried many ways but I do not get any output at all. I have a list containing different types of strings:

I have a fasta file as below:

I'm new to programming in R and trying to do a very specific task.

I have a fasta sequence of n samples, which I read in ape:

My brother is a medical student and he came to me with a problem. He and 3 of his classmates have to rotate between two hospitals, say H1 and H2.

• H1 has a morning shift and a night shift. The morning shift is the most demanding one, so two people have to be there for it. The night shift can be covered by one person, this person would then take the rest of the following day off.

• H2 only has a morning shift and can be covered by a single person

I'm trying to solve this problem by looking it as a permutation of the following events:

• H1 morning shift (H1_M)
• H1 night shift (H1_N)
• H2 shift (H2)
• Rest day (R)

These events would have the following restrictions:

• No 24 hour shifts, so H1_N cannot follow H1_M
• A rest day always follows the night shift, so R always goes after H1_N
• 1 student is always on his rest day except on the first day, otherwise there is no solution

The problem is how to create 4 schedules, one for each student, which fulfill the two requirements above.

I've created sequences of events which follow the rules set above,

Hi I've got problem set in cs50 and having difficulties as this is my first week in Python and I would be appreciate if you don't directly write an open answer but forward me to the right functions or method to use.

We've been given a long string sequence in a .txt file, one line and no white spaces. I have to find the longest consecutive sequence of words of given DNA string

example txt: GGAGGCCAAAGTCTTGTGATATCGGGCAACTCCCCGGGAGGAACACAGGCCCACCGAAAACAGCTTGAAATGGGAAACGTTCCCGATCTACGCCGGGCCAGAGG

original text is around 5000 characters but it goes like the example below. My task is to find the longest consecutive sequences of 'AGATC' string.

lets say the first consequtive sequence is 23 times, after i kept reading and find another consequtive sequences in 34 times, I have to store the biggest number.

My problem is not to find a way to read and analyse a string in this way. I can read a string can find the total repetitive times and so on but finding the longest repetition is not making sense in every way I've tried. I thought C was hard but I can write this code with C so easily as I we can manipulate strings in so much way in C. At least in C there are ways to read in a size but as far as I see Python reads at once and there is no control over read. In Python it doesn't seem you can make much with, at least in my level of knowledge at the moment :/ Probably Python got one line solutions for this, please don't judge this is my 3rd day and 4th program in Python.

What functions or methods I should look to analyze a string in this way. I've watched videos for a similiar thing but for sequence of single character, not a string. Also bought the Python Crash Course to get some knowledge about the string manipulation but couldn't find anything related in this case. Also checked the Python documentation but obviously it's so much complicated for day 3 in Python.

Could anyone help me please.TIA

here is my not-working and not-making-sense code