ACTG | ACTG : Nucleotide syntax highlighting

by hackerfriendly Python Version: Current License: MIT

X-Ray Key Features Code Snippets Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | ACTG Summary

ACTG is a Python library. ACTG has no bugs, it has no vulnerabilities, it has a Permissive License and it has low support. However ACTG build file is not available. You can download it from GitHub.

Nucleotide syntax highlighting and reverse complement support. This is handy for "stare at the screen and squint" DNA analysis.

Support

Quality

Security

License

Reuse

Support

ACTG has a low active ecosystem.

It has 11 star(s) with 5 fork(s). There are 4 watchers for this library.

It had no major release in the last 6 months.

There are 1 open issues and 0 have been closed. On average issues are closed in 1488 days. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of ACTG is current.

Quality

ACTG has no bugs reported.

Security

ACTG has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

License

ACTG is licensed under the MIT License. This license is Permissive.

Permissive licenses have the least restrictions, and you can use them in most projects.

Reuse

ACTG releases are not available. You will need to build from source code and install.

ACTG has no build file. You will be need to create the build yourself to build the component from source.

Top functions reviewed by kandi - BETA

kandi has reviewed ACTG and discovered the below as its top functions. This is intended to give you an instant insight into ACTG implemented functionality, and help decide if they suit your requirements.

Performs the complement of the edit
Performs the complement of a sequence

Get all kandi verified functions for this library.

ACTG Key Features

No Key Features are available at this moment for ACTG.

ACTG Examples and Code Snippets

No Code Snippets are available at this moment for ACTG.

Community Discussions

Trending Discussions on ACTG

Removing lines which match with specific pattern from another file

Trying to get values form a list inside a JSON respons

How do I get my code to analyse parts of my table that meet a certain condition?

How to remove a character from every string in a list, based on the position where a specific character occurs in the first member of said list?

Running 1000 functions gracefully using python multi-processing

shuffle dictionary values in python

How to use a sorted list as a filter?

Interval expressions in gawk to awk

Concatenate columns while maintaining rows

Elixir characters being treated as integers, not characters when splitting to head and tail

QUESTION

Removing lines which match with specific pattern from another file

Asked 2021-May-05 at 12:44

I've got two files (I only show the beginning of these files) :

patterns.txt

...

ANSWER

Answered 2021-Feb-18 at 17:08

With your shown samples please try following. Written and tested in GNU awk.

Source https://stackoverflow.com/questions/66264259

QUESTION

Trying to get values form a list inside a JSON respons

Asked 2021-Apr-28 at 17:57

My goal is to loop over a JSON response, grab two values, and build out an API call to load information into a POST to create a policy I am building.

To start out on this, I am trying to get two values from a JSON response to assign as variables to build the POST call, which will be the second step to this. As each different "id" and "name" key is assigned, I would like to build out a JSON payload and send the POST calls one at a time. The keys "id" and "name" occurs multiple times in the response payload and I am having issues capturing the two keys.

JSON response

...

ANSWER

Answered 2021-Apr-28 at 17:57

The JSON response which you have given is already a dictionary so no need to use json.loads for that. The multiple item list is actually nested under the data key. So you could just simply iterate through the array of items like this:

Source https://stackoverflow.com/questions/67305209

QUESTION

How do I get my code to analyse parts of my table that meet a certain condition?

Asked 2021-Mar-03 at 20:46

I'm new to Python and have one small issue with my code. It works the way I want, but I only need it to work on certain rows of my original csv table.

An example of the table is:

I need my code to only run on the rows that are chromosomes. I tried to use an 'if' statement, but it didn't quite work. I have a list that pulls out the name, accession, start, stop and locus tag, since this is the info I need. I then iterate this list in a loop over my original file to get the data out like so:

...

ANSWER

Answered 2021-Mar-03 at 20:14

You seem to be using pandas for making of the table. In pandas if you want to keep only some part of your data, you can filter out the rows by using the following syntax:

Source https://stackoverflow.com/questions/66464106

QUESTION

How to remove a character from every string in a list, based on the position where a specific character occurs in the first member of said list?

Asked 2021-Feb-17 at 20:03

So I have a list of strings, all with the same length, like this:

...

ANSWER

Answered 2021-Feb-17 at 18:51

Solution using zip()

Source https://stackoverflow.com/questions/66247407

QUESTION

Running 1000 functions gracefully using python multi-processing

Asked 2021-Feb-01 at 15:16

I'm trying to receive stock data for about 1000 stocks, to speed up the process I'm using multiprocessing, unfortunately due to the large amount of stock data I'm trying to receive python as a whole just crashes.

Is there a way to use multiprocessing without python crashing, I understand it would still take some time to do all of the 1000 stocks, but all I need is to do this process as fast as possible.

...

ANSWER

Answered 2021-Jan-31 at 19:18

Ok, here is one way to obtain what you want in about 2min. Some tickers are bad, that's why it crashes.

Here's the code. I use joblib for threading or multiprocess since it doesn't work in my env. But, that's the spirit.

Source https://stackoverflow.com/questions/65980910

QUESTION

shuffle dictionary values in python

Asked 2021-Jan-08 at 18:40

I have a dictionary and I want to shuffle the values, not the keys. For example:

...

ANSWER

Answered 2021-Jan-08 at 09:55

You can use random.sample to get a random ordered list of the dict's values, then map them with the keys in their default order. At the difference of using shuffle you can do this in once

Source https://stackoverflow.com/questions/65626654

QUESTION

How to use a sorted list as a filter?

Asked 2020-Dec-25 at 05:01

I want to get all oneKmers that don't exist in in.txt.
in.txt is sorted in the same order as oneKmer at column 0.

It should be doable in O(N) instead of O(N^2) since both lists are in the same order.

How can I write this ?

...

ANSWER

Answered 2020-Dec-25 at 02:19

First, opening files many times cases slow so ACTG loop must be included in file loop. Second, Stdout is slow than you think, so stop print(onemake) and output to file directly. They must improve speed possibly.

Source https://stackoverflow.com/questions/65444616

QUESTION

Interval expressions in gawk to awk

Asked 2020-May-26 at 11:33

I hope this is an easy fix

I originally wrote a clean and easy script that utilized gawk, I used this first and foremost because when I was solving the original issue was what I found. I now need to adapt it to only use awk.

sample file.fasta:

...

ANSWER

Answered 2020-May-25 at 15:29

EDIT: As per OP comment need to print gene ids too then try following.

Source https://stackoverflow.com/questions/62001815

QUESTION

Concatenate columns while maintaining rows

Asked 2019-Nov-11 at 01:30

I have a numpy array that I would like to concatenate the columns into a single value for the row. Below is what I have tried so far.

...

ANSWER

Answered 2019-Nov-11 at 01:30

import numpy as np
randoma = np.random.choice(list('ACTG'),(5,21),replace=True)  # create a 7x21 raqndom matrix with A,C,T,G

new_list = [''.join(x) for x in randoma.tolist()]
new_list
['CGGGACGCACTTCCTGTGCAG',
 'TGTAGCGGCTTGGTGTCCAAG',
 'GAAAGTTTAGGATTGCGTCGG',
 'AGTATTGTGATTCTATCTGAC',
 'TTAGTAAGAGTGTCTCACTAT']

Source https://stackoverflow.com/questions/58794485

QUESTION

Elixir characters being treated as integers, not characters when splitting to head and tail

Asked 2019-Sep-20 at 04:55

I'm working on a basic problem with elixir - RNA transcription. However I'm hitting some unexpected (to me) behavior with my solution:

...

ANSWER

Answered 2019-Sep-20 at 00:55

You can use the ? code point operator:

Source https://stackoverflow.com/questions/58019729

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install ACTG

You can download it from GitHub.
You can use ACTG like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.

Support

ACTG and N are simply highlighted in place, which can make for some interestingly colored VCF comments and quality strings. A more clever regex would help, if only I could fathom the tmLanguage backreference match syntax.

Find more information at: