gata | data validation and transformation library | Validation library

I'm making a memory game in C#. It has 10 pairs of cards, total 20. It's supposed to work like this: When pressing the Start button, the game shuffles randomly the cards and reveals all cards. After 3 seconds it flips them. Then, the player has to find all pairs.

I'm having a problem with shuffling. I wrote this code. It's being executed when I press the Start button:

I've got a program to find DNA matches. We've been given a one line text file for finding the longest sequence of STR(Short Tandem Repeats) then match the result with a database which has been a .cvs file as below:

I'm attempting to work through finding the amount of consecutive STRs (a substring pattern, i.e. "AGAT") in a sequence file.

String Patterns: AGATC,TTTTTTCT,AATG,TCTAG,GATA,TATC,GAAA,TCTG

Sequence file(one of many other sequence files): AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG

In the above sequence, TATC is the maximum with a run of 5 consecutive TATC pairs. With my regular expression, it is returning matches whether they are consecutive or not.

I believe using regular expressions is my best bet. This is my first time working in Python so don't expect too much. I've used the regex tool at regex101.com and it has provided me some good insight into regex formulations. I'm passing a variable into the regex with {head}, which which is the string pattern, but I want to find the matched string {head} 2 or more times. My below regex returns a match to head at least 1 or more times, so I know why that is returning the way it does.

(Apologies this is gonna be a long question)

I just have a bug in my code that I have not been able to resolve for a very long time. I would really appreciate if someone could help me find out what the problem is.

Context: I have a long string of letters - lets call this subject - containing the letters A, G, T and C (like DNA) and the whole point of my algorithms is to correctly count how many of each of the following STRs are found within subject. The STRs are:

• AGATC
• TTTTTTCT
• AATG
• TCTAG
• GATA
• TATC
• GAAA
• TCTG

I must count how many of each are within subject. Counting works by going sequentially letter by letter until the start of one of above STRs are found. If the rest of the STR follows, the program should update the counter of the respective STR and then boost the searching index to account of the length of the STR and then keep going. It should stop when it reaches the end of subject. (Hope it makes sense).

My Code:

I'm trying to build a notebook for beginners as me, to plot the Google Gata Mobility Report, but I'm having trouble adjusting on a single image all the plots and save them on a single file. What can I do to get that output?

Here's the original code:

I'm hoping you can help point me in the right direction as I'm very new to programming and Python in particular. I'm trying to find maximum repeat counts of certain substrings in a larger string. For example, how many times does 'AGATC' repeat in a much longer string (it might appear only at one place but four times in a row at another place).

I've been reading up on regex for this and have written the code below. It will successfully print out repetitions for each pattern seperately, however, I need to know the repetition count for when it appears. Example output of my code looks like this:

I have a dictionary that contains the following:

PSet 6 DNA from CS50.

I have CSV file with header and values:

I'm trying to get value from API using amp-state but the problem is it's like you need to do an action to get the data.