ena | An Elastic Net Algorithm for the Traveling Salesman Problem

by larose Python Version: Current License: BSD-2-Clause

X-Ray Key Features Code Snippets Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | ena Summary

ena is a Python library. ena has no bugs, it has no vulnerabilities, it has a Permissive License and it has low support. However ena build file is not available. You can download it from GitHub.

An Elastic Net Algorithm for the Traveling Salesman Problem

Support

Quality

Security

License

Reuse

Support

ena has a low active ecosystem.

It has 4 star(s) with 4 fork(s). There are 2 watchers for this library.

It had no major release in the last 6 months.

ena has no issues reported. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of ena is current.

Quality

ena has 0 bugs and 0 code smells.

Security

ena has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

ena code analysis shows 0 unresolved vulnerabilities.

There are 0 security hotspots that need review.

License

ena is licensed under the BSD-2-Clause License. This license is Permissive.

Permissive licenses have the least restrictions, and you can use them in most projects.

Reuse

ena releases are not available. You will need to build from source code and install.

ena has no build file. You will be need to create the build yourself to build the component from source.

It has 329 lines of code, 46 functions and 6 files.

It has high code complexity. Code complexity directly impacts maintainability of the code.

Top functions reviewed by kandi - BETA

kandi has reviewed ena and discovered the below as its top functions. This is intended to give you an instant insight into ena implemented functionality, and help decide if they suit your requirements.

Generate a function to draw an elastic solution
Combine an iterable
Draw a graph of neurons
Draws an intermediate solution
Run the optimizer
Calculate the neurons
Return True if stopping criterion is less than max_iter
Perform iteration
Compute the solution of a permutation
Compute the distance between two points
Draw the final solution
Draw the edges
Write a solution to output directory
Print stop criteria
Print starting distance
Parse arguments
Print the algorithm information
Decode the solution of the given distribution
Create the output directory
Creates an instance from a file
Print a summary of the optimization
Prints the list of parameters

Get all kandi verified functions for this library.

ena Key Features

No Key Features are available at this moment for ena.

ena Examples and Code Snippets

No Code Snippets are available at this moment for ena.

Community Discussions

Trending Discussions on ena

pandas: group years by decade

Get data from pandas on specifics string

Run AlgoliaSearch Autocomplete if query text is greater than 3-4 characters

Assign multiple values to one latch

How to trim the header in a fasta sequence to the species name and keeping the main text of the sequence using sed command?

C++ how to make if statements more efficient

Pandas - why looping with str.extract is faster than one str.extractall

Download tsv file from link which generates the file upon request, using bash

In Dash (python), I have problem with slider and radioitem callback

Why does my program makes my robot turn the power off?

QUESTION

pandas: group years by decade

Asked 2022-Apr-16 at 04:26

So I have data in CSV. Here is my code.

...

ANSWER

Answered 2022-Apr-16 at 04:17

I see two simple options.

1- round the years to the lower 10:

Source https://stackoverflow.com/questions/71891015

QUESTION

Get data from pandas on specifics string

Asked 2022-Apr-16 at 02:48

So here is my code.

...

ANSWER

Answered 2022-Apr-16 at 02:48

import pandas as pd

data = pd.read_csv('cast.csv')
data_2 = data[data['type'] == 'actor']
output = data_2[data['name'].str.startswith('Aaron')]
print(output)

Source https://stackoverflow.com/questions/71890633

QUESTION

Run AlgoliaSearch Autocomplete if query text is greater than 3-4 characters

Asked 2022-Apr-04 at 18:43

I am trying to limit AlgoliaSearch to show results for Autocomplete only if the uer types more than 3-4 charchters in the input box, I have tried using keypress event in jquery to do this but unfortunately that does not work, I tried searching Algolia blogs but to no avail. Below is my code,

...

ANSWER

Answered 2022-Apr-04 at 18:43

Found the solution on Algolia Automcomplete.js documentation on Github here: https://github.com/algolia/autocomplete/blob/45fa32d008620cf52bf4a90530be338543dfba7f/README.md#global-options. The solution is to recreate the source property in order to obtain the typed query.

Source https://stackoverflow.com/questions/71684377

QUESTION

Assign multiple values to one latch

Asked 2022-Feb-24 at 18:25

I need a latch which can take multiple bus with one enable signal for each and when this signal is high, the latch takes the value of the associated bus, something like this :

I tried this :

...

ANSWER

Answered 2022-Feb-24 at 18:25

I don't think you can get rid of the warnings in the first two examples—you have a bonafide race condition between the latch enable and the data feeding the latch. It is more obvious in your first example.

When load goes to 0, temp will be changing to Z ( a don't care most likely 0) at the same time the latch enable goes to 0. Which one happens first is clearly a race.

Source https://stackoverflow.com/questions/71256000

QUESTION

How to trim the header in a fasta sequence to the species name and keeping the main text of the sequence using sed command?

Asked 2022-Feb-16 at 16:00

The fasta file name: STD_PRO_1.fasta

I have multiple headers in that fasta file as such:

>ENA|AB000176|AB000176.1 Escherichia coli DNA for mannosyl transferase, phosphoribosyl-ATP pyrophosphohydrolase:phosphoribosyl-AMP cyclohydrolase, partial cds. GACCATATGATTGACGCCTATGTCAATCTCTACACTACATTGCTGGAAAGCAAATCCTGA GAGATGCTACCCCCGCCGTTGCTGCGGGGGCCAACGCGTTAATGCCGATTCTTCAGATTA TCAATCACTTCTCCGAGATCCAGCCCTTGATCCTGCAACAACACCAGCAGGTGATACATC AAATCAGATGCCTCGTTGGTCAGTTCAAAGCGGTCATGTACTGTCGCTGCCAGTGCGGTT

>ENA|AB000178|AB000178.1 Escherichia coli DNA for mannosyl transferase, phosphoribosyl-ATP pyrophosphohydrolase:phosphoribosyl-AMP cyclohydrolase, partial cds. GACCATATGATTGACGCCTATGTCAATCTCTACACTACATTGCTGGAAAGCAAATCCTGA GAGATGCTACCCCCGCCGTTGCTGCGGGGGCCAATGCGTTAATGCCGATTCTTCAGATTA TCAATCACTTCTCCGAGATCCAGCCCCTGATCCTGTAACAGCACCAGCAGGTGATACATC AAATCAGATGCCTCGTTGGTCAGCTCAAAGCGGTCATGTACCGTTGGTGCCAGTGCGGTT

To keep only the species name in the header as follows:

>Escherichia coli GACCATATGATTGACGCCTATGTCAATCTCTACACTACATTGCTGGAAAGCAAATCCTGA GAGATGCTACCCCCGCCGTTGCTGCGGGGGCCAACGCGTTAATGCCGATTCTTCAGATTA TCAATCACTTCTCCGAGATCCAGCCCTTGATCCTGCAACAACACCAGCAGGTGATACATC AAATCAGATGCCTCGTTGGTCAGTTCAAAGCGGTCATGTACTGTCGCTGCCAGTGCGGTT

>Escherichia coli GACCATATGATTGACGCCTATGTCAATCTCTACACTACATTGCTGGAAAGCAAATCCTGA GAGATGCTACCCCCGCCGTTGCTGCGGGGGCCAATGCGTTAATGCCGATTCTTCAGATTA TCAATCACTTCTCCGAGATCCAGCCCCTGATCCTGTAACAGCACCAGCAGGTGATACATC AAATCAGATGCCTCGTTGGTCAGCTCAAAGCGGTCATGTACCGTTGGTGCCAGTGCGGTT

...

ANSWER

Answered 2022-Feb-16 at 16:00

Before:

Source https://stackoverflow.com/questions/71141788

QUESTION

C++ how to make if statements more efficient

Asked 2022-Feb-12 at 13:04

So i wrote a program to manipulate a file with questions and answers to a specific order so a program by the name of active presenter can read it and turn it into a quiz. I am pretty new to coding and my code is garbage. I mostly wanna reduce the size of my if statements because i wanna include every word from the alphabet in it. How would i got about doing this?

my code:

...

ANSWER

Answered 2022-Feb-12 at 13:04

Note: I just took considered how to reduce the size of the if conditions without considering the possibility of other optimizations.

You could use the regex library to match the strings against patterns. If needed you could also add capturing groups to extract info about the position of substrings.

The following code simply checks prints output to the console depending on the patterns matched:

Source https://stackoverflow.com/questions/71091935

QUESTION

Pandas - why looping with str.extract is faster than one str.extractall

Asked 2021-Dec-07 at 22:04

I have a dataframe (~100k rows) with strings that I need to extract multiple items from and create new columns for.

Sample Data

...

ANSWER

Answered 2021-Dec-07 at 22:04

According to the source code extractall works with lists and appends to these which can be a slow if used frequently.

extractall tries to stay dynamic since it will capture all possible matches and therefore also iterates through the whole string, extract will return on the first match. If you only care about the first match you can also just use extract maybe like this:

Source https://stackoverflow.com/questions/70267207

QUESTION

Download tsv file from link which generates the file upon request, using bash

Asked 2021-Nov-15 at 23:11

I need to download .txt files which are generated from links like this one: https://www.ebi.ac.uk/ena/portal/api/filereport?accession=SRP002480&result=read_run&fields=fastq_ftp&format=tsv&download=true&limit=0 but I need to download it in the bash shell. It works perfectly fine on Firefox, on the shell I tried wget and curl to no avail. I read lots of similar question in Stack Overflow and other pages, tried everything I could find, but couldn't find a solution. For example:

...

ANSWER

Answered 2021-Nov-15 at 23:11

It works for me:

Source https://stackoverflow.com/questions/69981748

QUESTION

In Dash (python), I have problem with slider and radioitem callback

Asked 2021-Nov-14 at 12:04

Upon callback I get two errors:

Property "slidevalue" was used with component ID: "ageslider" in one of the Input items of a callback. This ID is assigned to a dash_core_components.RangeSlider component in the layout, which does not support this property.
TypeError: 'NoneType' object is not subscriptable

My code is:

...

ANSWER

Answered 2021-Nov-14 at 12:04

It should be value instead of slidevalue

Source https://stackoverflow.com/questions/69958965

QUESTION

Why does my program makes my robot turn the power off?

Asked 2021-Oct-19 at 05:05

I'm trying to put together a programmed robot that can navigate the room by reading instructions off signs (such as bathroom-right). I'm using the AlphaBot2 kit and an RPI 3B+.

the image processing part works well, but for some reason, the MOTION CONTROL doesn't work. I wrote a simple PID controller that "feeds" the motor, but as soon as motors start turning, the robot turns off.

...

ANSWER

Answered 2021-Oct-03 at 14:33

It is probably not the software. Your power supply is not sufficient or stable enough to power your motors and the Raspberry Pi. It is a very common problem. Either:

Use separate power supplies which is recommended
Or Increase your main power supply and use some short of stabilization of power

What power supply and power configuration are you using?

Source https://stackoverflow.com/questions/69425729

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install ena

You can download it from GitHub.
You can use ena like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at: