LSTR | official repository of End-to-end Lane Shape Prediction | Machine Learning library
kandi X-RAY | LSTR Summary
kandi X-RAY | LSTR Summary
LSTR: Lane Shape Prediction with Transformers.
Support
Quality
Security
License
Reuse
Top functions reviewed by kandi - BETA
- Train the model
- Prints a log message to stdout
- Update the deque
- Load pre - trained model
- Draw an annotation
- Convert a list of lane tuples to LineString
- Get an annotation
- Transform an annotation
- Compute loss curves
- Helper function for parallel_apply
- Load data from file
- Evaluate the evaluation
- Parse command line arguments
- Calculates the polynomial with the given degree
- Compute the loss for each label
- Forward computation
- Fetch data from queue
- Parse log file
- Perform the forward computation
- Benchmark the prediction
- Get all tensors from all ranks
- KP image detection
- Plot the loss
- Compute the classification cost matrices
- Calculate loss
- Evaluate the prediction
LSTR Key Features
LSTR Examples and Code Snippets
Community Discussions
Trending Discussions on LSTR
QUESTION
well, I have 2 lists (names and bilananu2017) names contains the names of companies and bilananu2017 contain a pdf of each company there is some missing links the problem is that names length is 80 and bilananu2017 length is 75 i want both lists to be the same length so I can make a data frame. I have this idea of adding a string "null" in bilananu2017 for each missing link basically ill compare each company name with all the link if there a link that contains the campany name then append the link in a new list if not append("null") so at the end ill have a new list with the length of names where there is null for each missing link i tried this code
...ANSWER
Answered 2021-Mar-24 at 19:21Try this it will work fine:
QUESTION
GCC thinks I have
...ANSWER
Answered 2021-Feb-26 at 17:18To understand what's going on you just need to break the types down, so in:
QUESTION
Need to get some part of the java string, example below:
String lstr = "/nw-resource-pool:resource-pools/numeric-pools[name='testpool'][scope='1.1.1.1-component-id-cab-1-slot-1-card-1-pxc-1-1-3-dir']/used-resources[value='346']";
would like to fetch after scope=' text...
o/p: 1.1.1.1-component-id-cab-1-slot-1-card-1-pxc-1-1-3-dir
tried below, any better approach
...ANSWER
Answered 2021-Feb-26 at 16:10You could use String#replaceAll for a one-liner solution:
QUESTION
I expected them to be stored in the text segment, but a short investigations revealed they are not (I used clang compiler). So where then are they stored? The pointers to anonymous objects are defined globally (outside any scope) like this:
ANSWER
Answered 2020-Dec-06 at 11:52Compilers commonly put string literals in a read-only section because they are read-only. Similarly, initialized non-read-only data is put in a modifiable data section because that is what it is for.
A compound literal is not read-only unless it is defined with a const-qualified type, so a compiler is likely to put a non-const-qualified compound literal in a modifiable section.
(Of course, the C standard allows C implementations to arrange memory as they like, so a compiler is not obligated to use the same section for compound literals that it uses for other data.)
QUESTION
(Apologies this is gonna be a long question)
I just have a bug in my code that I have not been able to resolve for a very long time. I would really appreciate if someone could help me find out what the problem is.
Context:
I have a long string of letters - lets call this subject - containing the letters A, G, T and C (like DNA) and the whole point of my algorithms is to correctly count how many of each of the following STRs are found within subject. The STRs are:
AGATCTTTTTTCTAATGTCTAGGATATATCGAAATCTG
I must count how many of each are within subject. Counting works by going sequentially letter by letter until the start of one of above STRs are found. If the rest of the STR follows, the program should update the counter of the respective STR and then boost the searching index to account of the length of the STR and then keep going. It should stop when it reaches the end of subject.
(Hope it makes sense).
My Code:
...ANSWER
Answered 2020-Oct-05 at 16:13Does this help?
QUESTION
I am doing an exercise to get to know the shared pointer and weak pointer.
So the example is with cyclic dependence of shared_ptr and how could I solve the problem with weak_ptr.
I want to initialize the root->left->parent to root and the same for right node but it is giving me segmentational fault.
Does anybody know something about this problem, how should I write and initialize it?
Here is my code.
Just to know, my first exercise was to do it all with only shared pointer, but after that to change parent to be the weak_ptr, so that's why there are commented lines
Thanks in advance
...ANSWER
Answered 2020-Aug-14 at 11:34// if (parent != nullptr) pStr = parent->name;
pStr = parent.lock()->name;
QUESTION
I want to detect if the user is connected over SSH. In a term, the "env" command shows SSH_CONNECTION line. Accessed in Python in one of two ways:
...ANSWER
Answered 2017-Jun-08 at 01:17The OpenSSH daemon writes an entry to /var/run/utmp with the current terminal, the IP and the name of the user. Check the output of the w or who commands that parse /var/run/utmp.
It's just a question of getting the current terminal (similar to the tty command) and extracting the information you want.
Use pyutmp like this:
QUESTION
I need help! I was trying to mod a game BombSquad and was trying to build a banning system for my server.
okay so there is a funtion that denies people to enter
...ANSWER
Answered 2018-Jun-12 at 10:51try: import file1
and then use file1.xyz
QUESTION
This problem boils down to the following problem; given a source file, automatically place open and closing braces for optional control blocks in C/C++. These blocks are if, else, do, while, and for afaik.
I am attempting to trace and analyze various loops, statements, and the like in a massive code repository that I have not written myself. My end goal is to perform timing statistics on all loops (will be expanded to other things in the future, but out of scope for this problem) in a given source of code. These trace functions do various things, but they all follow a similar issue; being placed before and after a block of interest is executed.
In essence, I want to transform the code:
...ANSWER
Answered 2020-Feb-11 at 01:57You are going down a rabbit hole. The more cases you run into the more cases you will run into until you have to write an actual parser for C++, which will require learning a whole technology toolchain.
Instead I would strongly recommend that you simplify your life by using a formatting tool like clang-format that already knows how to parse C++ to first rewrite with consistent formatting (so braces are now always there), and then you just need to worry about balanced braces.
(If this is part of a build process, you can copy code, reformat it, then analyze reformatted code.)
Note, if the code makes interesting use of templates, this might not be enough. But it will hopefully get you most of the way there.
QUESTION
I'm downloading .jar files from libraries.minecraft.net and repo1.maven.org using WinHTTP (over HTTPS). Here's the function:
ANSWER
Answered 2019-Nov-05 at 03:28Community Discussions, Code Snippets contain sources that include Stack Exchange Network
Vulnerabilities
No vulnerabilities reported
Install LSTR
You can use LSTR like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.
Support
Reuse Trending Solutions
Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items
Find more librariesStay Updated
Subscribe to our newsletter for trending solutions and developer bootcamps
Share this Page
