ctc | Primer on CTC implementation in pure Python PyTorch code | Machine Learning library

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

Disclaimer: I'm coming back to scripting after more than a decade (and I was a novice to begin with) so apologies if the question is mundane but help is much needed and appreciated.

I'm trying to modify a python script to log me into a job portal, search job vacancies based on attributes and then apply to said jobs.

Since the portal opens new vacancies on separate tabs, the code is supposed to go to the next tab and test the criteria on the job description

The code snippet is as below:

With Maven I have the jackson "databind" and "dataformat-xml" dependencies alongside JUNIT 4. I have created a simple Java class called "Simple Bean" with two initialised integers. Using an instance of the XmlMapper class I tried to write its' method writeValue however it throws the exception: "InvalidDefinitionException" with the message "No serializer found for class SimpleBean and no properties discovered to create BeanSerializer". I added the serialization annotation but it returns with an incorrectly formatted class name.

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

I'm new to the MUI library. I've managed to build a nav bar and it works fine for one route (Dashboard). But for the candidate route it collapses as shown : Screengrab of candidate route where the nav bar collapses

Screen grab of the dashboard route where the nav bar doesn't break : Screen grab of Dashboard route where nav bar renders as expected

Drawer code:

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

I want to change database (h2 to SQL) in JBPM

from

i just tried to do a JS which is closing my menu when i press a "

I have array like this