atat | no_std crate for parsing AT commands

I have the following sequences, as you might guess I only want the characters A,C,G,T,- and ignore the rest. Length of the input file may change and there may be a line such as sequence747 etc.

"sequence1 ATAC---CTAATTGGAGATGATCAAATTTATAAT"

"sequence2 TTAT---CTAATTGGCGACGATCAAATTTATAAT"

"sequence3 ATAT---CTAATTGGTGATGATCAAATTTATAAT"

"sequence4 ATCA---TTAATTGGAGATGATCAATCCTAATGA"

"sequence5 CTGTACTTTTATTGGTGATAGTCAAATCTATAAT"

So far I have tried this and it works as I wanted:

I have SELECT statment like this

I was wondering if it's possible to parse any fixed width file without knowing anything about it and making it into a CSV. My intuition says no because there could be some edge cases. If you know the width, but not the column names, then that's fine. If you know the column names, then you can figure out the width, so that's fine. But if you don't have both, I can imagine that perhaps with smart enough logic you could do it if you read the file over once before you actually start parsing. perhaps. But if that's also a constraint (must read the file once), then you're out of luck, correct? Also assume that this is being streamed because the file is 50GB and cannot be loaded into memory. So, to go over my goal and constraints:

Goal: To successfully convert a fixed width file having no information about it, most notably the column names and the width length

Constraints: 1. I am expecting the file to be very large, so I must stream it and not load it into memory, and it would be terribly inefficient to read it twice. 2. I have no information on the column names, the width, or anything really - I am just receiving a fixed width file.

Given these constraints, is the goal possible? I know that in the simple case, say something like this:

How to remove an array from json array in react js. I tried something like this. but not working

Now the response is directly set to atate as follows

I am looking for a regex expression that allows (or ignores) an apostrophe? I'm fairly new to regex and I looked at other similar questions but didn't find the help I need.

I am using a textbox to search an RTB and match all words with a specific or common ending (i.e. the search term inserted in the textbox). Then, I need to pass all matches to a second RTB.

I have tried many different expressions including: \b\w*[-']\w*\b but the program either separates the word at the apostrophe, finds only words with an apostrophe, or lists all words as matches?

My sample list of words to search is:

mi'iria, mi'i, piraria, makuptiaria, netap, hap, kuap, uimikuaptiaria, uhyt, set, uipu'aptiaria, mu'ap, atat, hat, haria, yat. (commas are not in the original list)!

As you can see, there are words that end in "ria" which contain an apostrophe and words that do not. I want to match all words that end with "ria," but I get results like: mi as one match, iria as another match and piraria, makuptiaria, uimikuaptiaria and haria aren't matched?

I need an expression that will allow (or ignore) the apostrophe so that all words that end in "ria" are matched independent of whether they contain an apostrophe or not. Also, words which contain an apostrophe (i.e. similar to mi'iria) should not be separated because of the apostrofe. Can anyone help on this? I am very grateful for any help! Thanks!

Okay, I spent some time tinkering on https://regex101.com/r/X4oL0y/1 and came up with the following expression which matches all words that end with "ria" including those with and those without an apostrophe:

we are trying to achieve round robin algorithm using linked list. But My logic has some errors. When I try to run it for 3 process then the first process values are wrong and sometimes right for the other below processes. Please Help me.

I tried Searching for logics

Code Link: https://pastebin.com/FkbtUEaQ

I am trying to write a command to grep the number of occurrences in a string, but my string is "ATATAT" and I want to grep "ATAT". I am expecting to get 2 outputs when I use command I get only 1.

I have a list of lists:

EDIT: Adding that this is basically how I wanted it to work:

User input #1:

(#1 Option 1a)(#1 Option 1b)

(#1 Option 2a)(#1 Option 2b)

(#1 Option 3a)(Option3b)

User input #2:

(#2 Option 1a)(#2 Option 1b)

(#2 Option 2a)(#2 Option 2b)

(#2 Option 3a)(#2 Option3b)

From user input #1, there is a

• 50% chance of either option 1a or 1b
• 50% chance of either option 2a or 2b
• 50% chance of either option 3a or 3b

From user input #2, there is a

• 50% chance of either option 1a or 1b
• 50% chance of either option 2a or 2b
• 50% chance of either option 3a or 3b

If the randomly rolled chance is more than 50 out of 100, then it chooses "a". If the randomly rolled chance is equal or less than 50 out of 100, then it chooses "b".

(#1 randomized choice of 1st gene a or b)(#2 randomized choice of 1st gene a or b)

(#1 randomized choice 2nd gene a or b)(#2 randomized choice 2nd gene a or b)

(#1 randomized choice of 3rd gene a or b)(#2 randomized choice of 3rd gene a or b)

and so on and so forth.

I just started coding with c++ a few days ago and I started on this project to get the ball rolling.

So far it has worked, but I'm running into an issue where I want to remove a sub(?) string "nn" from the results of previous cout(s). However, since it's already printed to the console, I don't think I can edit it. Is there any way around this?

This project is an "RNG" roller and for those who are familiar with MMOs, might know how if a player is about to receive loot, the game decides what you get by chance.

In this project, I am having the user input the genetic code (genotype) of the parent horses, and have this spit out a randomly generated genotype of the foal (baby horse) given the possibilities from their parents. (I hope that made sense.)

I've tried adding