iPG | iPG Y-Combinator Interview Simulator

I'm trying to build a simple Discord bot which finds information about a specific stock when its name or symbol is inputted by the user. I included my code which web-scraped all the data into another document, but it's included in my bot.py file. I have it set up so that when I type viewall, a list of all the stocks should appear. However, when typing that command in my Discord server, I get nothing. However, the output on my terminal is:

after uploading to the host I get this message when I try to change something in the database via ajax knowing that it is working well in localhost

In Angular-12, I am working on dynamic input formarray:

JSON:

The hinhanh must be an image.

The hinhanh must be a file of type: ipg, png, jpeg, gif, svg.

The hinhanh has invalid image dimensions.

could you help me to solve the following task, please?

My dataframe has the following content:

1 BEN 2 BIIB 3 BMY 4 COG 5 GPS 6 HAL 7 IPG 8 LLY 9 LOW 10 LUV 11 MRK 12 PSX 13 RMD 14 ROP 15 STT 16 UAA

I would like to save the dataframe df as a txt file. But I need the txt output in the following format (separated by commas): BEN,BIIB,BMY,COG,GPS,HAL,IPG,LLY,LOW,LUV,MRK,PSX,RMD,ROP,STT,UAA

I tried to use:

I am currently attempting to run a for loop on about 500 stock tickers and attempting to create a chart for all of them. I have succeeded in doing this but my for loop breaks on this error Error in runSum(x, n) : n = 20 is outside valid range: [1, 5] I got the stock tickers from BatchGetSymbols library.

Here is my script at the bottom is my for loop:

I am using Angular 8 for my Angular-Electron application. I have a field as API-Key stored in a tabular format which is quite sensitive and needs to be shown to user on user's account page. The problem is it needs to be shown as a password text-field. Whenever user will click on a button called "Show", the API-key would be visible for a few seconds perhaps or until user clicks the button again. It cannot be shown as an input field.

This is how the user account details are shown to user:

(I need to repeatedly do the search for hundreds of times):

1. Search (e.g. "WP_000177210.1") in "https://www.ncbi.nlm.nih.gov/ipg/"

(i.e. https://www.ncbi.nlm.nih.gov/ipg/?term=WP_000177210.1)

2. Select the first record in the second column "CDS Region in Nucleotide" of the table

(i.e. " NC_011415.1 1997353-1998831 (-)", https://www.ncbi.nlm.nih.gov/nuccore/NC_011415.1?from=1997353&to=1998831&strand=2)

3. Select "FASTA" under the name of this sequence

4. Get the fasta sequence

(i.e. ">NC_011415.1:c1998831-1997353 Escherichia coli SE11, complete sequence ATGACTTTATGGATTAACGGTGACTGGATAACGGGCCAGGGCGCATCGCGTGTGAAGCGTAATCCGGTAT CGGGCGAG.....").

1. Search (e.g. "WP_000177210.1") in "https://www.ncbi.nlm.nih.gov/ipg/"