cgg | a pl0 parser implemented by Python | Parser library

I have a sequence of DNA of "atgactgccatggaggagtc". The problem told me to decompose it into triplets and translate the triplets into proteins. I have the code that do that. However at the end there are only 2 nucleotides left, so I can't make a triplet out of it. How can I tell Python to list "-" instead if a triplet doesn't have 3 nucleotides in it?

Both degeneracy1 and protein_ls are not being reassigned in the nested while loops I am using, I can't figure out why this. This program is designed to find the best protein motif to create an oligo for genetic engineering. Both degeneracy1 and protein_ls are listed near the bottom of the python code.

Here's some things I need help with.
But first of all, please let me pull up the code first.

Here's what I'm doing:

I am writing code that modifies a 3 letter sequence at all 3 positions separately by exchanging that position with one of the following A, T, C, or G.

I have been able to create 3 lists where the initial element has either the 1st, 2nd, or 3rd position modified to one of the other 3 different letters.

I have written a dictionary that encodes each key (amino acid in this case) and it's corresponding codon sequences (which would be the elements I am modifying). .

Now, I aim to check each modified list's elements against this dictionary, and see which dict key they correspond to. I wish see if changes in the initial element change the resulting key associated with it.

I am unable to figure out how to proceed; how can I get the corresponding key for the values of my modified lists?

Here is my code so far:

I am trying to write a stored procedure that would increment one of the column in the table by 1, everytime either of the country code (AXX,XPP,CGG) is given as user input, depending on the already existing country code value

I have been struggling with turning a list of DNA sequences into amino acid sequences. The function i wrote should read the DNA list in three nucleotides. It should loop over the sequences in the list and translate each sequence, using codons in a directory. Now I know that this problem isn't exactly new and that Biopython has a translation module made for that kind of stuff. The difficulty lies in that I later want to use a degenerate codon directory, with an NNK-codon code (K being G or T) and as far as my research went there is no possibility to make custom codon dics with Biopython. Also the DNA sequences that I use aren't uniform in length.

Now I think it's time to go a little more in depth and explain where my data aka. the list of DNA sequences is coming from. The sequences (ranging from a couple 1000 to more than 1 million) are random nucleotides in between to markers that I isolated via a function using a regex search written to a text file. The structure of this file looks like this:

CACCAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGTCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGATGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC CAGCATTAGGAGCCGGCTGATGAGAGTGAGAATAGAAA CCAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATC TAAACAGCTTGATACCGATAGTTGTGCCGACAATGACAACAACCATCGCCCACGCATAACCGATATATTC

What i tried is to read in the file and get a list of all sequences as strings, get rid of whitespaces and newline breaks and that kind of stuff. Start a function in which the codon usage is defined and loop over the list of sequences for each sequence in a three letter fashion, translating them to the amino acid defined by the codon in the dict.

Code I got so far:

I have a very simple one liner that works almost perfectly. I want to add a new column to a file that says "non coding or coding" depending on conditions on columns 12 and 3 (if column 12 has substring RNA or mir- and/or column 3 == "pseudogene then column 1 should read non-coding else coding).

I have two files