StringSearch | various string matching algoriths in C | Learning library

by joaomsa C Version: Current License: No License

X-Ray Key Features Code Snippets Community Discussions(10)Vulnerabilities Install Support

kandi X-RAY | StringSearch Summary

StringSearch is a C library typically used in Tutorial, Learning, Example Codes applications. StringSearch has no bugs, it has no vulnerabilities and it has low support. You can download it from GitHub.

Currently implemented: Naive search algorithm; Knuth-Morris-Pratt (KMP) algorithm; Boyer-Moore-Horspool (BMH) algorithm; Bitap (Shift-And) algorithm;. Parameters and return values are the same as strstr() from string.h allowing simple drop in replacement. Main program meant to solve:

Support

Quality

Security

License

Reuse

Support

StringSearch has a low active ecosystem.

It has 10 star(s) with 6 fork(s). There are 2 watchers for this library.

It had no major release in the last 6 months.

StringSearch has no issues reported. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of StringSearch is current.

Quality

StringSearch has no bugs reported.

Security

StringSearch has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

License

StringSearch does not have a standard license declared.

Check the repository for any license declaration and review the terms closely.

Without a license, all rights are reserved, and you cannot use the library in your applications.

Reuse

StringSearch releases are not available. You will need to build from source code and install.

Top functions reviewed by kandi - BETA

kandi's functional review helps you automatically verify the functionalities of the libraries and avoid rework.
Currently covering the most popular Java, JavaScript and Python libraries. See a Sample of StringSearch

Get all kandi verified functions for this library.

StringSearch Key Features

No Key Features are available at this moment for StringSearch.

StringSearch Examples and Code Snippets

No Code Snippets are available at this moment for StringSearch.

Community Discussions

Trending Discussions on StringSearch

Im trying to string search from a range of lines in a text file but the stringsearch outputs empty

Error: Acumatica SOAP API release invoice from Invoices and Memos screen(AR301000)

How to add more strings to the combined string if the length is less than prescribed length?

C Programming: alternative way of creating a test string and letting the user search for the character within the string vs source code

Microsoft graph search feature Java

Searching for a String in a .txt file and getting the row and column number in Java

I want to find the index of the string in an array

How can I find string in a given sequneces and copy whole sequence to another textfield?

Getting an error when trying to retrieve all files from Acumatica Sales Order through the API

Handling Acumatica timeout on API Invoke action

QUESTION

Im trying to string search from a range of lines in a text file but the stringsearch outputs empty

Asked 2021-Apr-07 at 09:16

stringSearch=[]
line2=input("What starting line number do you need? ")
line1=input("What closing line number do you need? ")


string = input("What string do you like to search in this test case: ")
with open('texfile') as f:
    lines = f.readlines()
    for line in lines:
        if line[int(line1):int(line2)].__contains__(string):
            stringSearch.append(line)
            print ("String found")
            print (stringSearch)

...

ANSWER

Answered 2021-Apr-07 at 08:34

Suggestions

Variable naming

Why line2 followed by line1? Better to name in successive order i.e. line1, line2.

Or even better relate variable name to its purpose and use Python naming convention thus:

Source https://stackoverflow.com/questions/66980000

QUESTION

Error: Acumatica SOAP API release invoice from Invoices and Memos screen(AR301000)

Asked 2020-Nov-13 at 03:19

I'm trying to release an especific invoice from Invoices and Memos screen (AR301000) using the SOAP API as documented in the I210 Contract Based Web Services guide.

Debugging my code, When I release the especific invoice I get this error:

...

ANSWER

Answered 2020-Nov-13 at 03:19

The first thing you need to make sure that your invoice is not on hold - if it is on hold then the entity returned by the Get will be empty. That could be a problem.

Also, can you please try using ReleaseInvoice() instead of Release() in the invoke?

InvokeResult invokeResult = client.Invoke(invoice, new ReleaseInvoice());

That has worked for me in the past.

Source https://stackoverflow.com/questions/64809777

QUESTION

How to add more strings to the combined string if the length is less than prescribed length?

Asked 2020-Nov-04 at 07:03

In iOS I am using two strings to combine and to form a single string. But the combined string must be of 16 characters . So if two strings are small and if we combine both and if it is less than 16 characters I must add few more characters to make it to 16 characters. How to achieve this?

...

ANSWER

Answered 2020-Nov-04 at 07:03

Something like below

Source https://stackoverflow.com/questions/64674480

QUESTION

C Programming: alternative way of creating a test string and letting the user search for the character within the string vs source code

Asked 2020-Mar-09 at 09:54

This lab is trying to show the use of coder-defined functions to execute the code, but I'm trying to do it alternatively so when we actually are tested on it I won't be freaking out that I just copied the source code.

...

ANSWER

Answered 2020-Mar-09 at 09:54

Apart from the issues pointed out in the comments there is some things you should improve:

char * string = (char *) malloc(WordSize * sizeof(char)); is the same as char * string = malloc(WordSize), but for a 20 word string we will need char * string = malloc(WordSize + 1)
This part of the code:

Source https://stackoverflow.com/questions/60356650

QUESTION

Microsoft graph search feature Java

Asked 2020-Mar-04 at 08:24

I'm trying to use Microsoft Graph to make a file search. I use this entry point : https://graph.microsoft.com/beta/search/query My application do not use a user account but a daemon with an application key (see auth method). And i send a built object.

My java code is rather simple :

...

ANSWER

Answered 2020-Mar-04 at 08:24

First of all, you should check if the access token is valid, you can send a request using postman.

If the token is valid, I think it should be the problem of your jsonInputString. The following code works fine.

Source https://stackoverflow.com/questions/60455495

QUESTION

Searching for a String in a .txt file and getting the row and column number in Java

Asked 2020-Feb-01 at 13:33

I am currently stuck with a problem. I am supposed to write a programm that is able to search for a string in a .txt file given as argument. The programm must return the row and the column of the found string. I am struggling to find a way to achieve that and have no idea how to go on. I would be very happy to hear from you.

Here is my attempt in tackling with my task: - I thought about saving the content of a file via a buffered reader in a string array, but that does not seem to work since I cannot define the length of the array from the beginning - I also thought about saving the content of the file via a buffered reader in a string and then split this string in characters. However I am not sure how I will be able to retreieve the rows in the original file then.

This is the non-functional code that I have at the moment:

...

ANSWER

Answered 2020-Feb-01 at 13:09

Here's one approach -

Let's consider a counter which holds a counter for all the readLine() method invocations - representing the "row" in the .txt file. So, increment the counter after every readLine call in the while loop.
Next, split the line on " " (space) to get an array of each word in the line. Then, you could iterate over this array and match the word to the search string. The position of array index at the time the match was found will represent the "column".

Source https://stackoverflow.com/questions/60016947

QUESTION

I want to find the index of the string in an array

Asked 2019-Dec-20 at 16:39

I have to search a string in an array from the user input, but I have an error in my logic. Even when the user input is in the array I still get "data not found"

I also have to display the index where the string is located in the array if it's found but got an error there too.

Below is the code I've tried.

This was the original question

create a program that ask user to insert 5 names.

store names in array

ask user to insert the name they want to find from the list created earlier

if name found, display "data found at [index]"

if not, display "data not found". Hint; use Java method equals to compare two strings.

...

ANSWER

Answered 2019-Dec-20 at 16:39

You are comparing the whole array to a single string, that will always return false.

It's the same as:

Source https://stackoverflow.com/questions/59417072

QUESTION

How can I find string in a given sequneces and copy whole sequence to another textfield?

Asked 2019-Mar-28 at 14:18

I need to find given sequence in textarea and copy it to another field. For example my input and textarea would be like this :

Input: CGGGAGGAA
Texarea:
@M04644:45:147451:110237731
AGGGCGATGTCCTGGGATACGCGGGTGTCACGGGAGGAACCTGATCTGCCCAAATCTG
+
11>1AD?DAC333EFFAFGGGGCC9A-9;A--9-AAFB?--99-@A9--/;/B/;:
@a0add382:1aaaa1:11023:24dsa31
AGGGCGATGTCCTGGGATACGCGGGTGTCATATGCCTTCCTGATCTGCCCAACCATCTG
+
11>1AD?DAC333EFFAFGGGGCC9A-9;A--9-AAFB?--99-@A9--/;/B/;:
.
.
.

and this text keeps going on. Now I want to find all the CGGGAGGAA sequences from the textarea value and push the previous line, the line contains CGGGAGGAA and the next two lines into second textarea. So my second area would be like this :

@a0add382:1aaaa1:11023:24dsa31
AGGGCGATGTCCTGGGATACGCGGGTGTCATATGCCTTCCTGATCTGCCCAACCATCTG
+
11>1AD?DAC333EFFAFGGGGCC9A-9;A--9-AAFB?--99-@A9--/;/B/;:

Any help is much appreciated. Thanks in advance.

...

ANSWER

Answered 2019-Mar-28 at 14:18

Split the input text on end-of-line character

search through each line

if found, push the appropriate values to the array

Source https://stackoverflow.com/questions/55399371

QUESTION

Getting an error when trying to retrieve all files from Acumatica Sales Order through the API

Asked 2019-Feb-22 at 16:18

I'm successfully generating three files through the API. The code I'm using to do that is here:

...

ANSWER

Answered 2018-Dec-18 at 15:55

I tested the following example and it worked in my environment. This might require troubleshooting.

Try removing and adding back the service reference, try multiple sales order, restart the application (IISReset).

Source https://stackoverflow.com/questions/53835431

QUESTION

Handling Acumatica timeout on API Invoke action

Asked 2019-Jan-31 at 15:28

I have code in a standalone application that invokes an Acumatica action to generate reports; I am running into timeouts on large documents while the action completes.

What is the best method to handle these timeouts? I need to wait for the action to complete in order to retrieve the files I've generated.

Standalone application code:

...

ANSWER

Answered 2019-Jan-30 at 07:52

I believe the reason why you encounter time-out is because there is no TCP communication between the time you sent the request and receive the response. With TCP KeepAlive flag set to true, the client will periodically ping the server to reset the time-out period.

That would be the best way. However Acumatica connections are rather high level so I don't think you'll be able to easily access that flag. What I would try first in a scenario that doesn't involve external application is to wrap your action event-handler code in a PXLongOperation block which has to do something similar to keep connection alive under the hood:

Source https://stackoverflow.com/questions/54425780

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install StringSearch

You can download it from GitHub.

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at: