biomojify | Convert bioinformatics files to an emoji format | Genomics library

Β by Β  fastqe Python Version: 0.3.1.0 License: BSD-3-Clause

kandi X-RAY | biomojify Summary

kandi X-RAY | biomojify Summary

biomojify is a Python library typically used in Artificial Intelligence, Genomics applications. biomojify has no bugs, it has no vulnerabilities, it has build file available, it has a Permissive License and it has low support. You can install using 'pip install biomojify' or download it from GitHub, PyPI.

biomojify reads one or more input FASTA, FASTQ, or VCF (experimental) files, and converts them to emoji.
Support
    Quality
      Security
        License
          Reuse

            kandi-support Support

              biomojify has a low active ecosystem.
              It has 6 star(s) with 3 fork(s). There are no watchers for this library.
              OutlinedDot
              It had no major release in the last 12 months.
              There are 11 open issues and 4 have been closed. On average issues are closed in 2 days. There are no pull requests.
              It has a neutral sentiment in the developer community.
              The latest version of biomojify is 0.3.1.0

            kandi-Quality Quality

              biomojify has no bugs reported.

            kandi-Security Security

              biomojify has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

            kandi-License License

              biomojify is licensed under the BSD-3-Clause License. This license is Permissive.
              Permissive licenses have the least restrictions, and you can use them in most projects.

            kandi-Reuse Reuse

              biomojify releases are available to install and integrate.
              Deployable package is available in PyPI.
              Build file is available. You can build the component from source.
              Installation instructions are not available. Examples and code snippets are available.

            Top functions reviewed by kandi - BETA

            kandi has reviewed biomojify and discovered the below as its top functions. This is intended to give you an instant insight into biomojify implemented functionality, and help decide if they suit your requirements.
            • Convert a VCF file to human readable format
            • Retrieve quality value for a given quality
            • Returns a filter string
            • Get vcf emoji
            • Convert fastq files into mapping
            • Log an error message
            • Convert fasta file to FASTA format
            • Convert FASTA files to YAML format
            • Parse command line arguments
            Get all kandi verified functions for this library.

            biomojify Key Features

            No Key Features are available at this moment for biomojify.

            biomojify Examples and Code Snippets

            Overview,FASTA files
            Pythondot img1Lines of Code : 21dot img1License : Permissive (BSD-3-Clause)
            copy iconCopy
            $ cat test.fasta 
            >SEQUENCE_1
            ATAGTCAGTACGTAGTCGATGCTAGCTAGTAGGGGGGCTGATGATGTAGCTCGATCGTACGTACGTACGCTGAGTCAGTG
            CACGTACGCTGCATGCCNTAGNCTAAAAGNCTANGCTAGCNTANGCTGACTNAGNTGACTGCNTCGTCGNATCATGTACG
            TAGCGAGCTTTTTTTAGTGTACGTAGTACTACCCCCCCCCGTACGTACGTACGTC  
            Overview,Help message
            Pythondot img2Lines of Code : 17dot img2License : Permissive (BSD-3-Clause)
            copy iconCopy
            $ biomojify --help
            usage: biomojify [-h] [--version] [--log LOG_FILE] {fasta,fastq} ...
            
            Read one or more FASTA files, and convert them to emoji.πŸ˜€
            
            positional arguments:
              {fasta,fasta_protein,fastq,vcf}
                                    sub-command help
                  
            Overview,FASTQ files
            Pythondot img3Lines of Code : 12dot img3License : Permissive (BSD-3-Clause)
            copy iconCopy
            $ cat test.fq
            @ Sequence
            GTGCCAGCCGCCGCGGTAGTCCGACGTGGC
            +
            GGGGGGGGGGGGGGGGGGGGGG!@#$%&%(
            
            $ biomojify fastq test.fq
            ▢️  Sequence
            πŸ‡πŸ…πŸ‡πŸŒ½πŸŒ½πŸ₯‘πŸ‡πŸŒ½πŸŒ½πŸ‡πŸŒ½πŸŒ½πŸ‡πŸŒ½πŸ‡πŸ‡πŸ…πŸ₯‘πŸ‡πŸ…πŸŒ½πŸŒ½πŸ‡πŸ₯‘πŸŒ½πŸ‡πŸ…πŸ‡πŸ‡πŸŒ½
            πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸ˜πŸš«πŸ˜„πŸ‘ΊπŸ’”πŸ™…πŸ‘Ύ  

            Community Discussions

            QUESTION

            search for regex match between two files using python
            Asked 2022-Apr-09 at 00:49

            IΒ΄m working with two text files that look like this: File 1

            ...

            ANSWER

            Answered 2022-Apr-09 at 00:49

            Perhaps you are after this?

            Source https://stackoverflow.com/questions/71789818

            QUESTION

            Is there a way to permute inside using to variables in bash?
            Asked 2021-Dec-09 at 23:50

            I'm using the software plink2 (https://www.cog-genomics.org/plink/2.0/) and I'm trying to iterate over 3 variables.

            This software admits an input file with .ped extention file and an exclude file with .txt extention which contains a list of names to be excluded from the input file.

            The idea is to iterate over the input files and then over exclude files to generate single outputfiles.

            1. Input files: Highland.ped - Midland.ped - Lowland.ped
            2. Exclude-map files: HighlandMidland.txt - HighlandLowland.txt - MidlandLowland.txt
            3. Output files: HighlandMidland - HighlandLowland - MidlandHighland - MidlandLowland - LowlandHighland - LowlandMidland

            The general code is:

            ...

            ANSWER

            Answered 2021-Dec-09 at 23:50

            Honestly, I think your current code is quite clear; but if you really want to write this as a loop, here's one possibility:

            Source https://stackoverflow.com/questions/70298074

            QUESTION

            BigQuery Regex to extract string between two substrings
            Asked 2021-Dec-09 at 01:11

            From this example string:

            ...

            ANSWER

            Answered 2021-Dec-09 at 01:11

            use regexp_extract(col, r"&q;Stockcode&q;:([^/$]*?),&q;.*")

            if applied to sample data in your question - output is

            Source https://stackoverflow.com/questions/70283253

            QUESTION

            how to stop letter repeating itself python
            Asked 2021-Nov-25 at 18:33

            I am making a code which takes in jumble word and returns a unjumbled word , the data.json contains a list and here take a word one-by-one and check if it contains all the characters of the word and later checking if the length is same , but the problem is when i enter a word as helol then the l is checked twice and giving me some other outputs including the main one(hello). i know why does it happen but i cant get a fix to it

            ...

            ANSWER

            Answered 2021-Nov-25 at 18:33

            As I understand it you are trying to identify all possible matches for the jumbled string in your list. You could sort the letters in the jumbled word and match the resulting list against sorted lists of the words in your data file.

            Source https://stackoverflow.com/questions/70112201

            QUESTION

            Split multiallelic to biallelic in vcf by plink 1.9 and its variant name
            Asked 2021-Nov-17 at 13:56

            I am trying to use plink1.9 to split multiallelic into biallelic. The input is that

            ...

            ANSWER

            Answered 2021-Nov-17 at 09:45

            QUESTION

            Delete specific letter in a FASTA sequence
            Asked 2021-Oct-12 at 21:00

            I have a FASTA file that has about 300000 sequences but some of the sequences are like these

            ...

            ANSWER

            Answered 2021-Oct-12 at 20:28

            You can match your non-X containing FASTA entries with the regex >.+\n[^X]+\n. This checks for a substring starting with > having a first line of anything (the FASTA header), which is followed by characters not containing an X until you reach a line break.

            For example:

            Source https://stackoverflow.com/questions/69545912

            QUESTION

            How to get the words within the first single quote in r using regex?
            Asked 2021-Oct-04 at 22:27

            For example, I have two strings:

            ...

            ANSWER

            Answered 2021-Oct-04 at 22:27

            For your example your pattern would be:

            Source https://stackoverflow.com/questions/69442717

            QUESTION

            Does Apache Spark 3 support GPU usage for Spark RDDs?
            Asked 2021-Sep-23 at 05:53

            I am currently trying to run genomic analyses pipelines using Hail(library for genomics analyses written in python and Scala). Recently, Apache Spark 3 was released and it supported GPU usage.

            I tried spark-rapids library start an on-premise slurm cluster with gpu nodes. I was able to initialise the cluster. However, when I tried running hail tasks, the executors keep getting killed.

            On querying in Hail forum, I got the response that

            That’s a GPU code generator for Spark-SQL, and Hail doesn’t use any Spark-SQL interfaces, only the RDD interfaces.

            So, does Spark3 not support GPU usage for RDD interfaces?

            ...

            ANSWER

            Answered 2021-Sep-23 at 05:53

            As of now, spark-rapids doesn't support GPU usage for RDD interfaces.

            Source: Link

            Apache Spark 3.0+ lets users provide a plugin that can replace the backend for SQL and DataFrame operations. This requires no API changes from the user. The plugin will replace SQL operations it supports with GPU accelerated versions. If an operation is not supported it will fall back to using the Spark CPU version. Note that the plugin cannot accelerate operations that manipulate RDDs directly.

            Here, an answer from spark-rapids team

            Source: Link

            We do not support running the RDD API on GPUs at this time. We only support the SQL/Dataframe API, and even then only a subset of the operators. This is because we are translating individual Catalyst operators into GPU enabled equivalent operators. I would love to be able to support the RDD API, but that would require us to be able to take arbitrary java, scala, and python code and run it on the GPU. We are investigating ways to try to accomplish some of this, but right now it is very difficult to do. That is especially true for libraries like Hail, which use python as an API, but the data analysis is done in C/C++.

            Source https://stackoverflow.com/questions/69273205

            QUESTION

            Aggregating and summing columns across 1500 files by matching IDs in R (or bash)
            Asked 2021-Sep-07 at 13:09

            I have 1500 files with the same format (the .scount file format from PLINK2 https://www.cog-genomics.org/plink/2.0/formats#scount), an example is below:

            ...

            ANSWER

            Answered 2021-Sep-07 at 11:10

            QUESTION

            Usage of compression IO functions in apache arrow
            Asked 2021-Jun-02 at 18:58

            I have been implementing a suite of RecordBatchReaders for a genomics toolset. The standard unit of work is a RecordBatch. I ended up implementing a lot of my own compression and IO tools instead of using the existing utilities in the arrow cpp platform because I was confused about them. Are there any clear examples of using the existing compression and file IO utilities to simply get a file stream that inflates standard zlib data? Also, an object diagram for the cpp platform would be helpful in ramping up.

            ...

            ANSWER

            Answered 2021-Jun-02 at 18:58

            Here is an example program that inflates a compressed zlib file and reads it as CSV.

            Source https://stackoverflow.com/questions/67799265

            Community Discussions, Code Snippets contain sources that include Stack Exchange Network

            Vulnerabilities

            No vulnerabilities reported

            Install biomojify

            You can install using 'pip install biomojify' or download it from GitHub, PyPI.
            You can use biomojify like any standard Python library. You will need to make sure that you have a development environment consisting of a Python distribution including header files, a compiler, pip, and git installed. Make sure that your pip, setuptools, and wheel are up to date. When using pip it is generally recommended to install packages in a virtual environment to avoid changes to the system.

            Support

            For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .
            Find more information at:

            Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items

            Find more libraries
            Install
          • PyPI

            pip install biomojify

          • CLONE
          • HTTPS

            https://github.com/fastqe/biomojify.git

          • CLI

            gh repo clone fastqe/biomojify

          • sshUrl

            git@github.com:fastqe/biomojify.git

          • Stay Updated

            Subscribe to our newsletter for trending solutions and developer bootcamps

            Agree to Sign up and Terms & Conditions

            Share this Page

            share link