quagmir | isomiR quantification and analysis pipeline | Genomics library
kandi X-RAY | quagmir Summary
kandi X-RAY | quagmir Summary
A python-based miRNA sequencing pipeline for isomiR quantification and analysis.
Support
Quality
Security
License
Reuse
Top functions reviewed by kandi - BETA
Currently covering the most popular Java, JavaScript and Python libraries. See a Sample of quagmir
quagmir Key Features
quagmir Examples and Code Snippets
Lines of Code : 31License : Permissive (MIT)
CopyYOUR_FILE_HERE.fastq_ready
>miRNA_name miRNA_motif
miRNA_consensus_sequence
>passenger-shRNA-mir21-ORF59-5p-1 ACACCCTGGCCGGGT
CCGACACCCTGGCCGGGTTGT
# DISPLAY
min_ratio: .001
min_read: 9
display_summary: True
display_sequence_info: True
displ Community Discussions
Trending Discussions on quagmir
QUESTION
I have to compare using Spark-based big data analysis data sets (text files) that are very similar (>98%) but with very large sizes. After doing some research, I found that most efficient way could be to use delta encoders. With this I can have a reference text and store others as delta increments. However, I use Scala that does not have support for delta encoders, and I am not at all conversant with Java. But as Scala is interoperable with Java, I know that it is possible to get Java lib work in Scala.
I found the promising implementations to be xdelta, vcdiff-java and bsdiff. With a bit more searching, I found the most interesting library, dez. The link also gives benchmarks in which it seems to perform very well, and code is free to use and looks lightweight.
At this point, I am stuck with using this library in Scala (via sbt). I would appreciate any suggestions or references to navigate this barrier, either specific to this issue (delata encoders), library or in working with Java API in general within Scala. Specifically, my questions are:
Is there a Scala library for delta encoders that I can directly use? (If not)
Is it possible that I place the class files/notzed.dez.jar in the project and let sbt provide the APIs in the Scala code?
I am kind of stuck in this quagmire and any way out would be greatly appreciated.
...ANSWER
Answered 2020-Oct-24 at 10:14There are several details to take into account. There is no problem in using directly the Java libraries in Scala, either using as dependencies in sbt or using as unmanaged dependencies https://www.scala-sbt.org/1.x/docs/Library-Dependencies.html: "Dependencies in lib go on all the classpaths (for compile, test, run, and console)". You can create a fat jar with your code and dependencies with https://github.com/sbt/sbt-native-packager and distributed it with Spark Submit.
The point here is to use these frameworks in Spark. To take advantage of Spark you would need split your files in blocks to distribute the algorithm across the cluster for one file. Or if your files are compressed and you have each of them in one hdfs partition you would need to adjust the size of the hdfs blocks, etc ...
You can use the C modules and include them in your project and call them via JNI as frameworks like deep learning frameworks use the native linear algebra functions, etc. So, in essence, there are a lot to discuss about how to implement these delta algorithms in Spark.
QUESTION
In my rocker/rstudio-derived docker container, I'm engulfed in a quagmire surrounding the yearly TexLive update and the R package tinytex.
I have gone through a plethora of iterations of tinytex::install_tinytex(), tinytex::uninstall_tinytex(), tinytex::reinstall(), etc.
I have installed the most current version via remotes::install_github("yiuhi/tinytex").
I have experimented with different (up to date) mirrors of CTAN.
When using a up to date mirror and having installed/reinstalled tinytex properly, I keep getting this behavior:
ANSWER
Answered 2020-Apr-17 at 10:45The observed behavior was a bug in the tinytex R package and has since been resolved (https://github.com/yihui/tinytex/issues/197).
Until the CRAN-available version is >= 0.21.5, one may remedy the behavior by installing directly from the author's repository by:
QUESTION
I am trying to write a convenience wrapper for os_log in Swift 4 / iOS 11, but I've run into an uphill battle with passing the variadic arguments.
Basically, I want to write a function that looks like the following.
...ANSWER
Answered 2020-Mar-12 at 05:14Did some more research on this. Turns out that os_log is actually a C macro. This created all sorts of problems with how it maps in to Swifts variadic args.
However, that macro also captures other debugging info and is probably not safe to wrap up anyways.
QUESTION
This exports one file with 2 rows in it. How can export 2 files each with one row in it?
...ANSWER
Answered 2020-Mar-07 at 12:36Just make a new File and use it like this
$file2 = fopen("contacts2.csv", "w");
fputcsv($file2, $list[1]);
You always write in the same file here, because you are refering to $file
fputcsv($file, $list[1]);
QUESTION
I have this piece of code which is kind of working but not properly as i want. I have a form which has two select boxes and when the user changes the value of each an ajax call is made and the page updates the records matching the options chosen.
This bit is working fine.
However when the user is filtering the records by changing the select options but wants to return to display all the records (so resetting the options) by selecting "all" in both select boxes, nothing is being displayed? I have a if query which i thought would of worked to set the value of $sql depending if $query is empty or not.
Here is my html/php page
...ANSWER
Answered 2019-Oct-16 at 16:08You are resetting the $query variable to '' inside the for loop every time.
QUESTION
I followed the guide on w3schools but I can't manage to make the script return the data I want when I choose a user from the dropdown menu. I just get undefined index: userdrop Here is the script (changed the GET with POST, maybe that's what I messed up)
...ANSWER
Answered 2019-Jun-14 at 00:46function UserInfo(str) { //method starts with str as an argument
var string = str; //str is assigned to string.
var http = new XMLHttpRequest(); // create new HttpRequest instance
var url = "testing.php"; //the script to call to post data
var params = 'id=string';
http.open("POST", url, true);
//Send the proper header information along with the request
http.setRequestHeader('Content-type', 'application/x-www-form-urlencoded');
// Call a function when the state changes.
http.onreadystatechange = function() {
if(http.readyState == 4 && http.status == 200) {
alert(http.responseText);
}
}
http.send(params);
}
QUESTION
index.php
...ANSWER
Answered 2017-Jan-19 at 06:52Reason is because You are always looking for the first selectbox value not the selectbox.Change your function to this:
QUESTION
My old parents have been hacked/virus-ed for the nth time.
I have an old HP server.
I thought of rebuilding it with VMWare (free version) or Oracle virtualbox and having them use windows in a controlled environment. I would back it up and patch it, etc. Maybe they RDC to my server.
I assume I would need a Windows server license to allow multiple connections. (I could also use it for myself to host Plex media server.)
At a 10,000 foot level, is this possible or just a technology quagmire?
...ANSWER
Answered 2019-Mar-03 at 16:27Super User SE might be a better place for this.
Anyway: Are they using it for anything windows-specific? My parents used to use my Linux-based computer for web browsing, now they use an Android tablet for the same. Running a virtualised Windows on top of the former could've been an alternative. Also, backing up and rolling back is easier if you use virtualisation, just use something else for permanent data storage. Maybe a remote storage with backup and rollback (for ransomware) either your own infrastucture or in the cloud. (like syncthing, owncloud, etc.)
I'm assuming here they don't have trade secrets or plans of a home-built nuclear plant or anything that kind.
QUESTION
I'm trying to print this simple line of code to understand what is the issue but it prints out entire HTML code instead absolutely ignoring the small array
...ANSWER
Answered 2018-Oct-04 at 13:34You have to write headers (Content-type, Cookies, etc.) before any other output is written. If you write headers after content they are silently discarded.
In some cases writing the headers after content may seem to work when output buffering is enabled and the buffer has not been flushed to the client already.
EDIT: As has been discovered in comments above the code may not work because the webpage seems to have been outputed directly in front of the CSV data. In this case one has to split the request for the webpage and for the CSV into two parts. One could for example use an GET/POST parameter (depending on the semantics) to distinguish what should be returned or use PATH_INFO (if the server is configured that way).
QUESTION
I don't know how to proceed and need your help!
The goal is to use multiple
Right now I've found a script and got it working by using
and as seen in the script below.
But instead of this drop down list, I want the If you need any more info please let me know!
AJAX:
...ANSWER
Answered 2018-Aug-22 at 18:59Used this answer that was posted but deleted, so if anyone have the same issue this is the way to go: ANSWER
Community Discussions, Code Snippets contain sources that include Stack Exchange Network
Vulnerabilities
No vulnerabilities reported
Install quagmir
Go into local quagmir folder: cd quagmir
Install Python dependencies: conda env create -f environment.yml
Add your .fastq samples into the data folder (a sample has been provided for testing):
Edit the motif-consensus.fa file to insert your miRNA information with the following format:
Edit the config.yaml file to change configuration options if needed (default values fine in most use cases):
Run pipeline: bash run.sh or activate conda env and run snakemake
Support
Reuse Trending Solutions
Find, review, and download reusable Libraries, Code Snippets, Cloud APIs from over 650 million Knowledge Items
Find more librariesStay Updated
Subscribe to our newsletter for trending solutions and developer bootcamps
Share this Page
