AGAT | Another Gtf/Gff Analysis Toolkit | Genomics library

I am making a music app where the user can add FX to playing music through a pad. I am using FFmpeg in C++ to dsp. In FFmpeg you can create an audio filter and set it parameters just like the following:

so i'm doing the dna problem for cs50 wherein i have to count the number of times a STR repeats in a dna sequence. i had an idea on how to solve the problem so i took one of the data and ran my code but the problem is that the program doesn't end and keeps running i think it has been about 10 minutes now from when i started the program and it still like this. here's the code:

When running a script in Python interpreter, I want to check if I use the following versions:

I am using Swashbuckle.AspNetCore for a project. The version I started with was 5.5.1 and when rendering results with large bodies (20k json rows), the speed was very reasonable (the data fetch takes 50ms and the rendering took less than a second. When I upgrade to 5.6.x, the syntax is now highlighted (which looks nice) but slows the rendering of those results to over 20 seconds. And once rendered, any action on the page that causes a refresh takes 20 seconds until the results are cleared.

After the usual searching, I want to try this solution (deactivating syntaxHighlight). I'm not sure how to do this via Swashbuckle.AspNetCore. Any suggestions?

I'm attempting to work through finding the amount of consecutive STRs (a substring pattern, i.e. "AGAT") in a sequence file.

String Patterns: AGATC,TTTTTTCT,AATG,TCTAG,GATA,TATC,GAAA,TCTG

Sequence file(one of many other sequence files): AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG

In the above sequence, TATC is the maximum with a run of 5 consecutive TATC pairs. With my regular expression, it is returning matches whether they are consecutive or not.

I believe using regular expressions is my best bet. This is my first time working in Python so don't expect too much. I've used the regex tool at regex101.com and it has provided me some good insight into regex formulations. I'm passing a variable into the regex with {head}, which which is the string pattern, but I want to find the matched string {head} 2 or more times. My below regex returns a match to head at least 1 or more times, so I know why that is returning the way it does.

I'm trying to set a conda environment using a requirements.txt file that a coworker shared with me. My coworker uses Python in a Mac without Anaconda, and I'm using it in a Windows machine with Anaconda. The file requirements.txt was generated with the command pip freeze and looks like this:

I've been using Spreadsheets and upwork, as I want to integrate between them.

So I'm trying to make authorization for upwork through spreadsheets, using the documentation steps and everything is going fine. But when i authorize my account i see that the response_type is not a token, it's a code.

I'm extremely new to programming in general and have only been learning Python for 1 week.

For a class, I have to analyze a text DNA sequence, something like this: CTAGATAGATAGATAGATAGATGACTA

for these specific keys: AGAT,AATG,TATC

I have to keep track of the largest number of consecutive repetitions for each, disregarding all but the highest number of repetitions.

I've been pouring over previous stackoverflow answers and I saw groupby() suggested as a way to do this. I'm not exactly sure how to use groupby for my specific implementation needs though.

It seems like I will have to read the text sequence from a file into a list. Can I import what is essentially a text string into a list? Do I have to separate all of the characters by commas? Will groupby work on a string?

It also looks like groupby would give me the highest incident of consecutive repetitions, but in the form of a list. How would I get the highest result from that list out of that list to them be stored somewhere else, without me the programmer having to look at the result? Will groupby return the highest number of consecutive repeats first in the list? Or will it be placed in order of when it occured in the list?

Is there a function I can use to isolate and return the sequence with the highest repetition incidence, so that I can compare that with the dictionary file I've been provided with?

Frankly, I really could use some help breaking down the groupby function in general.

My assignment recommended possibly using a slice to accomplish this, and that seemed somehow more daunting to try, but if that's the way to go, please let me know, and I wouldn't turn down a mudge in the direction on how in the heck to do that.

Thank you in advance for any and all wisdom on this.

I have a string of text named seq that has values like this: AATTDYAATTDUUAATTDAATTDAATTDAAAGATAGATAYAMMMCCMMMMMMMMM

Now I also have a list of values that stores these strings: ['AATTD','AGAT','MMM']. What I am trying to achieve with my code is to count how many times every word (not each letter) in the list appears in the text consecutively and store the count values of the string in a dictionary.

When I say consecutively, that means in this part of text above, AATTDYAATTDUUAATTDAATTDAATTD, the count for the value AATD should be only 3, because the other 2 are separated by Y and UU separately.

Here's what I have done with my code so far: