singlem | resistant microbial community profiling of shotgun | Genomics library

by wwood Python Version: v0.13.2 License: GPL-3.0

X-Ray Key Features Code Snippets(3)Community Discussions(1)Vulnerabilities Install Support

kandi X-RAY | singlem Summary

singlem is a Python library typically used in Artificial Intelligence, Genomics applications. singlem has no bugs, it has no vulnerabilities, it has build file available, it has a Strong Copyleft License and it has low support. You can download it from GitHub.

SingleM is a tool to find the abundances of discrete operational taxonomic units (OTUs) directly from shotgun metagenome data, without heavy reliance on reference sequence databases. It is able to differentiate closely related species even if those species are from lineages new to science. SingleM finds sequences (reads or genomic fragments) that encode conserved single copy marker genes. It specifically finds reads which cover short (20 amino acid / 60 base pair) highly conserved sections. These small sections are used as OTU sequences, that exist independent of taxonomy. Focusing on just those sequences that cover conserved stretches of singlem copy marker genes allows a variety of analyses become tractable. Where GraftM can give a taxonomic overview of your community e.g. proportion of a community from a particular taxonomic family, SingleM finds sequence-based OTUs from raw, untrimmed metagenomic reads.

Support

Quality

Security

License

Reuse

Support

singlem has a low active ecosystem.

It has 70 star(s) with 14 fork(s). There are 9 watchers for this library.

It had no major release in the last 12 months.

There are 20 open issues and 65 have been closed. On average issues are closed in 54 days. There are no pull requests.

It has a neutral sentiment in the developer community.

The latest version of singlem is v0.13.2

Quality

singlem has 0 bugs and 0 code smells.

Security

singlem has no vulnerabilities reported, and its dependent libraries have no vulnerabilities reported.

singlem code analysis shows 0 unresolved vulnerabilities.

There are 0 security hotspots that need review.

License

singlem is licensed under the GPL-3.0 License. This license is Strong Copyleft.

Strong Copyleft licenses enforce sharing, and you can use them when creating open source projects.

Reuse

singlem releases are available to install and integrate.

Build file is available. You can build the component from source.

Installation instructions, examples and code snippets are available.

singlem saves you 3296 person hours of effort in developing the same functionality from scratch.

It has 7076 lines of code, 364 functions and 57 files.

It has medium code complexity. Code complexity directly impacts maintainability of the code.

Top functions reviewed by kandi - BETA

kandi has reviewed singlem and discovered the below as its top functions. This is intended to give you an instant insight into singlem implemented functionality, and help decide if they suit your requirements.

Renew an OM cluster
Read an Archive OTU table
Write the tree to a file
Condense the tensorflow model
Wrapper around chainsaw
Convert the best position to a list of positions
Find the lowercase columns in the protein alignment
Compares the distance between two sequences
Return the taxonomy for this package
Generates a unifrac file for each gene
Exclude missing targets from the given package
Writes a clustered OTU table
Query the sequence database
Compile a GraftM package into a single package
Generate a Biobox Biobox Biopython table
Run single variant extraction
Write the translated OTU table to a table
Write the paired OTU and OTU table
Trims the given package
Generate a Metapackage
Create a taxonomic profile
Print the samples in the database
Compile a single GraftM package into a single package
Run a command via os system
Convert an OTU table into a KATTA table
Compile a single GraftM package

Get all kandi verified functions for this library.

singlem Key Features

No Key Features are available at this moment for singlem.

singlem Examples and Code Snippets

SingleM,Further processing of OTU tables,Calculating beta diversity between samples

Python

Lines of Code : 7

License : Strong Copyleft (GPL-3.0)

Copy

singlem summarise --input_otu_table otu_table.csv --unifrac_by_otu otu_table.unifrac

convertToEBD.py otu_table.unifrac.4.12.ribosomal_protein_L11_rplK.unifrac otu_table.ebd
ExpressBetaDiversity -s otu_table.ebd -c Bray-Curtis

singlem pipe --sequenc

SingleM,Further processing of OTU tables,Summarising OTU tables by rarefying, clustering, etc.

Python

Lines of Code : 5

License : Strong Copyleft (GPL-3.0)

Copy

singlem summarise --input_otu_tables otu_table.csv --krona my_krona.html

singlem summarise --input_otu_tables otu_table1.csv otu_table2.csv --output_otu_table combined.otu_table.csv

singlem summarise --input_otu_tables otu_table.csv --cluster --clu

SingleM,Generating an OTU table

Python

Lines of Code : 4

License : Strong Copyleft (GPL-3.0)

Copy

singlem pipe --sequences my_sequences.fastq.gz --otu_table otu_table.csv --threads 24

gene    sample  sequence        num_hits        coverage        taxonomy
4.21.ribosomal_protein_S19_rpsS my_sequences  TGGTCGCGCCGTTCGACGGTCACTCCGGACTTCATCGGCCTACA

Community Discussions

Trending Discussions on singlem

How to make async callback in node and make sure HTML form data is available for saving to db

QUESTION

How to make async callback in node and make sure HTML form data is available for saving to db

Asked 2017-Jul-29 at 05:49

How can I make callback and variables so that I can save data to my database?

I have node app.post like below. I need to convert form data to mongoose model. The data what I'm getting is in two arrays and only data which has amount larger than 0 is searched and saved, but this don't work and I can't get around it.

I think that looping and searching for ingredients should be a function and Meal.save should be in callback but I don't know how. I've been banging my head into this problem for weeks and I have googled, but this just does not open to me. Please help me with this.

Thanks in advance!

app.js

...

ANSWER

Answered 2017-Jul-29 at 05:49

You can check this stackoverflow answer for getting records respective to ids. mongodb/mongoose findMany - find all documents with IDs listed in array

Source https://stackoverflow.com/questions/45385532

Community Discussions, Code Snippets contain sources that include Stack Exchange Network

Vulnerabilities

No vulnerabilities reported

Install singlem

SingleM can be installed through Bioconda:.
A docker image generated from the conda package is available on DockerHub. After installing Docker, run the following, replacing [RELEASE_TAG] with a tag from https://hub.docker.com/r/wwood/singlem/tags:.
SingleM has migrated to Python 3. To install the Python libraries required:. You may need super-user privileges.
smafa >= 0.5.0
VSEARCH
sed - is standard on most linux systems
OrfM >= 0.2.0
HMMER >= 3.1b1
mfqe >= 0.5.0
pplacer >= 1.1.alpha17
KronaTools >= 2.4
diamond >= 2.0.0

Support

For any new features, suggestions and bugs create an issue on GitHub. If you have any questions check and ask questions on community page Stack Overflow .

Find more information at: